Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ICS2
Systematic Name YBR157C
Strain S288c
Description Protein of unknown function; null mutation does not confer any obvious defects in growth, spore germination, viability, or carbohydrate utilization
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ICS2 YBR157C
ATGGGCAAATTTGAGCAAAAAGAAAGAGAAAGAATAAGCACATTTAGTTTTCCTACTACG
GGCAGTCAATCTAGTACATCCATTAAATCACTTGGCAGCCCACTCTATGGACGTTTCAGC
TCTCTCTCTTCAACAGAATCTCAGTTCGATAGCAGCAAACAACCCCATGAGTACGAAAAG
AGCTTTTATTTTGAAGAGTCTCAAGGCGAAGCTCTGTTCAACAAGCTGAAGACCTACTCT
TTCCCTGGAGACAAGGATGGTGTGAAAACGAGGAGAAATTCCTCCATATGTCCAAGAAAG
CCTAATGCGGTATCACCTTTAAGGGTAGAAAGTAATGAATTATCATCACATTCGCATTCA
CGTTCATTATCACACGAACTTACAAAGCCTTCAGGGCGAAGGAAAAGTTACCACAGAAAA
AGTCATGCAATCTCATTCAGCAGGTCTTGTAAGCCAAATTTCATTGACGGGTACGATTCT
AATTCAAGCATAGGCGTCAATTCAAGAAAAACTTCATTGGCAAGTTCTTTCTTGGACAAA
GAATATCATTCTTCACCGGATACTTCATATACCCACCAAATGTCCCCGAAAAACACAATC
ATGAATACCAATGAACAATTAAGAAGAAACGCAAGCGGTAGATTCGGGAGTTTGAAAGAA
TTCGCTGAAAAAAATCAGATAAATATTGAGGGCAAAATTTTTGCTCATAAAGTGGAAACT
GGAGACATATTGCAACCACTAATTGACTTAGATATTGACAATAAATGA
Promoter Sequence
Download FASTA
>ICS2 YBR157C
CGAAGCTTCCGCAATTCTCACACACCAAAAAATGAGTTACCGGCCGTCTCTTCTTTTGCC
CCTCGCATATAATGGGATTGCGAACGGAGAACGACAGCAATATAACAAGCGTACGTGATC
CCTTTCATTCTGTTATATTCGAGAATAGTTGTTGACAGTGGAGATAACTCCGAAAATATC
ATGAAAAAGAGGGTTATTTCCGTTCGTCGGGACATTGCTGTAGAGCTCTTCAATGGCCAC
AACTTGGGAGCGTTAATATGCAATCAAGTTGTAGGGAAGATTATATCTCTCCAGGGATTA
TTACCTGGGACACAGAGCTCTTTTCCTTATCTCATCTCACGCATCTAGACCCTGCTAGCC
GTCGTTTCTTATTTGAAGCGTTAATCACCCTCACTTTTCGTCCGTAGCACGTAAAAAAGA
AAAATAGGGTACCGTTTACCTGTCGTTAATATGCAAGTCATTAACAATCCAGCCCAGTAC
TTTATTTGCTATGGCACGGCATAGGCGCAGGGAGTTCACGATTTGGTCATCAATGATTAT
CACGATATGGGGGTCCTTATGATCTTGATGTTCTTTCAACTGCTCTTTGTTTCTTTTTTT
TTTGTACGACAGTTTATGTGTTAAAGAACACATCCACTCCAATTTTGGGTCGTTTATACT
TTTGTTTCGCTAATCTTAAGCCAACCTTGAGTTTATACCTAATTATATGCCACGTTAATG
CACAAAACCCCTCGTAATAAACTTTCCTTGGAAGACTTTCTTTTTCTATTCGACGCATTT
GGTTACATATCTGTTGGGAAAGAGCCCTTCGACTGCAAGTCCGGCATCAAGAAAGCTTGA
CATCCAAAGAAGCATTTAAGTATAAATAAATGAGACCCATTCTATCTTCTCAAATAAATC
TTTTACAAATATGTGAACGTCAAAGCGCATACTTAATAAAAATTTATACTCTACACCACC
TTCGTTATTACTTCACTGAAGTTTCCCTTTCCAGCAAGAT
Chr coordinates Chr II from 554310-553543
w3c xhtml validator w3c css validator