Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IFA38
Systematic Name YBR159W
Alias ketoreductase
Strain S288c
Description Microsomal beta-keto-reductase; contains oleate response element (ORE) sequence in the promoter region; mutants exhibit reduced VLCFA synthesis, accumulate high levels of dihydrosphingosine, phytosphingosine and medium-chain ceramides
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IFA38 YBR159W
TGTTGTTTGCATTGCTTTGAATTGCCCGAAATTAAAAACATTTAACATTGGCAGACATAG
GCGTGGAAATTTAATTACGAGTGTCTCACTGGTCGCGCTAGGCAAATACACACAGGTGGA
AACTGTGGGGTTTGCCGGTTGTGATGTTGATGATGCCGGTATTTGGGAATTTGCTCGATT
AAATGGCAAAAATGTTGAAAGATTGTCTTTAAATTCCTGTCGTCTTTTGACTGATTACTC
TCTACCCATTCTTTTTGCTTTAAACTCATTTCCAAATCTGGCTGTTTTAGAGATCAGAAA
TTTAGATAAAATAACTGATGTGAGGCATTTCGTGAAGTACAACTTGTGGAAAAAATCATT
GGATGCCCCCATTCTAATCGAAGCATGTGAACGTATTACGAAACTAATCGATCAAGAAGA
AAATAGAGTTAAGAGGATTAACTCCTTGGTTGCCTTAAAAGATATGACAGCTTGGGTTAA
TGCAGACGACGAAATAGAGAATAATGTGGACTAGATGGTTTTTGTGACTTTACCTATAAA
TAGTACACAACAGACCACCAGTAATTCTACACACTTCTTAACTGATAATATTATTATAAT
TGTAACTTTTTAGCAGCACTAAATTTAATGAATACATAGATTTTTAACTAGCATTTTACT
ATTCTGTACTTTTTACTTGAAATTCCAGAAGGGCCGAAGAAACCAGAATTCCTTCACAGA
AAACTATTGAACTACAGAATTCTCCAAAAGATACACTCATAGTGTTAAGACGAATCAATG
TCTCGGATTTGGAAGTCCTTTATAGAGATAATTGTAGGGGCCTTTTGTAATGTTTCGGAT
GTTCTGTTTTAAGTCCGCGGGAGGCCTTTTTATTTTTCGCTTTTTTAGAGATTTCACGAA
TAAAAGCGTTGCAGAAATGCAACTTCAAAAGAGACTGAAGGAAACACAGATAGAAGAACA
GTCTTCAAAGCAATCAATTCGTGTCGGTGCAGCTTAAGAA
Chr coordinates Chr II from 558685-559728
w3c xhtml validator w3c css validator