Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SSE2
Systematic Name YBR169C
Strain S288c
Description Member of the heat shock protein 70 (HSP70) family; may be involved in protein folding; localized to the cytoplasm; highly homologous to the heat shock protein Sse1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSE2 YBR169C
GGCATCCTAATGTAAGCAAGTATAGCGAACAAGGTTTTTTTTCTTCCAAGTTTGTAACTT
GCGTTATATCAGGTAATTTGGAAGGTGAAATTGATATTTCGAGCTACCAAGTATCCACAG
AAGCTGAAGCATTGGTTACTGCAGATATGATAAGTGGGTCCACATTTCCTTCAATGGCAT
ATATTAATGACACTACAGATGAAAGATATGTACCTGAGATATTTTACATGAAGTCGAATG
AATATGGTATAACAGTGAAGGAAAATGCGAAGCCTGCATTTCCGGTAGACTATCTTTTAG
TGACGCTGACTCATGGGTTCCCGAATACCGATACGGAAACCAACTCGAAATTCGTTAGTT
CCACCGGATTTCCATGGAGCAATCGACAAGCTATGGGGCAATCTCAAGATTATCAAGAAT
TAAAAAAGTATTTATTCAATGTGGCTTCAAGTGGAGATTTCAATCTTTTGCATGAAAAAA
TCTCGAACTTTCATTTACTATTATACATAAATTCTCTGCAGATACTCTCTCCAGACGAAT
GGAAGTTACTAATAGAATCTGCTGTGAAAAATGAATGGGAAGAATCTCTACTAAAACTTG
TCTCATCGGCTGGTTGGCAAACGTTAGTCATGATCCTTCAGGAAAGCGGCTAGGAGAGAC
TGTAAGATTTGAGGTTTTAGATTAAAAAAATAGAAATGCGCGGAAGGTAAAATTGAGCCT
TTTTTATTTTAAAACTATGTAAATCATCCAAAATAGTAGACGTTTCTAGAACGTCCCCTT
ACCAAAAATCACATCATACGAGGAGTTTTAAGGAACAATAACTGGGAGTCGCTTTTACAA
ATTGGTATATATTAAGGTACTCTTGATATAAACCAAAGGACTTTGCCGTTTAGAGATTTT
TATTTATGAAATCTTGTATATAGATTTTGGAAATATCCCTTAAAACTTCCTTTTTTTTTT
TTTTTTACCTGTAACAGACGTAACCAAAGGATATAATATA
Chr coordinates Chr II from 575996-573915
w3c xhtml validator w3c css validator