Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SSE2
Systematic Name YBR169C
Strain S288c
Description Member of Hsp110 subclass of the heat shock protein 70 (HSP70) family; serves as nucleotide exchange factor to load ATP onto the SSA class of cytosolic Hsp70s; may be involved in protein folding; localized to the cytoplasm; SSE2 has a paralog, SSE1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSE2 YBR169C
GGCATCCTAATGTAAGCAAGTATAGCGAACAAGGTTTTTTTTCTTCCAAGTTTGTAACTT
GCGTTATATCAGGTAATTTGGAAGGTGAAATTGATATTTCGAGCTACCAAGTATCCACAG
AAGCTGAAGCATTGGTTACTGCAGATATGATAAGTGGGTCCACATTTCCTTCAATGGCAT
ATATTAATGACACTACAGATGAAAGATATGTACCTGAGATATTTTACATGAAGTCGAATG
AATATGGTATAACAGTGAAGGAAAATGCGAAGCCTGCATTTCCGGTAGACTATCTTTTAG
TGACGCTGACTCATGGGTTCCCGAATACCGATACGGAAACCAACTCGAAATTCGTTAGTT
CCACCGGATTTCCATGGAGCAATCGACAAGCTATGGGGCAATCTCAAGATTATCAAGAAT
TAAAAAAGTATTTATTCAATGTGGCTTCAAGTGGAGATTTCAATCTTTTGCATGAAAAAA
TCTCGAACTTTCATTTACTATTATACATAAATTCTCTGCAGATACTCTCTCCAGACGAAT
GGAAGTTACTAATAGAATCTGCTGTGAAAAATGAATGGGAAGAATCTCTACTAAAACTTG
TCTCATCGGCTGGTTGGCAAACGTTAGTCATGATCCTTCAGGAAAGCGGCTAGGAGAGAC
TGTAAGATTTGAGGTTTTAGATTAAAAAAATAGAAATGCGCGGAAGGTAAAATTGAGCCT
TTTTTATTTTAAAACTATGTAAATCATCCAAAATAGTAGACGTTTCTAGAACGTCCCCTT
ACCAAAAATCACATCATACGAGGAGTTTTAAGGAACAATAACTGGGAGTCGCTTTTACAA
ATTGGTATATATTAAGGTACTCTTGATATAAACCAAAGGACTTTGCCGTTTAGAGATTTT
TATTTATGAAATCTTGTATATAGATTTTGGAAATATCCCTTAAAACTTCCTTTTTTTTTT
TTTTTTACCTGTAACAGACGTAACCAAAGGATATAATATA
Chr coordinates Chr II from 575996-573915
w3c xhtml validator w3c css validator