Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EHT1
Systematic Name YBR177C
Strain S288c
Description Octanoyl-CoA:ethanol acyltransferase; also functions as thioesterase; plays a minor role in medium-chain fatty acid ethyl ester biosynthesis; localizes to lipid particles and the mitochondrial outer membrane; EHT1 has a paralog, EEB1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EHT1 YBR177C
GTCTTACTTAAGCTGGCAGAAACCTGTCACAGCACCACTGCCGGATATAGAAGGACAAAC
TAACGAGGGTCAGATTGGCCTAATGAAGTATTTGGGTTTGAAAAATTATCCTTTGACACA
ATATTGGTCAAGACCATCATTGCTCTTCACATCAAAAATTCCCACTCTAACGCTGTACTT
TCTAGGAAGTACAAAGGTTGTGGGGAACATTATATTAAACGGCATTAAATTATCGTCGTG
GAGCTCACTCAAGAAGTTATCAGTTCCGGTTATAGTGGTAGGTTCCTTGTTGGGACTTAC
GTATTTAATTCATGACCTCCCCCGTGCCTTACCAATGAATCTTTCCATTAAATACAAAAG
AAAGTTGCAAGAACTGGATTACATTCATCTTAACGCTCAAAGAACCTCAAATGAAGTACG
TGATGTTTTGCGTGTACCTACACGTGAAATTCTAAGGTCGTGTGAAATAATTATGGATAA
AAAACAAATCACTAAGAAAGAATTGGAAAACAAAAAAGAAAGTAACTTGTTGTCAATCAA
ATTCTTCCAATCTCTATACGAAGGAACCGTGGCTCAAAAATTGATGGTGGAAGAAATAAA
TTTAGACATCGATTAGATATTCTTGTAAATATATGAGGTCTTTTCAAATCAATATACATA
ATGTTACTTATTATTTTATTCCAAGCAGGTCCATTTTTTTTTTCACTTTGCACGAAATTA
CATAAACATTAAAAGGACCCTTGTGTATCTGCTTAATGATTTGCAAAACCTGCGGAAACG
GAACGAAAAATGAGCAATCTCGTTCCGGTTCCGAGATCCTTTTTTTTTTTTAAATCTTGC
GCATGTGCAGATTTTAAAAGGCGTCAGATATCGGATGTCCCTGGAAGTAATAGCTCCTCG
AGTATTTCCTCCGTTTATTATTAATATGAGCAGTTTTTTAAGTTCTATTATTACATTGAT
AGTAGTTGCGTAAAAAACAAAGCTCATAAAAGTTTCCGAT
Chr coordinates Chr II from 586162-584807
w3c xhtml validator w3c css validator