Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS6B
Systematic Name YBR181C
Alias eS6, LPG18, RPS101, RPS102, S6e
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; homologous to mammalian ribosomal protein S6, no bacterial homolog; phosphorylated on S233 by Ypk3p in a TORC1-dependent manner, and on S232 in a TORC1/2-dependent manner by Ypk1/2/3p; RPS6B has a paralog, RPS6A, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>RPS6B YBR181C
ATGAAGTTGAACATTTCTTACCCAGTCAACGGGTCTCAAAAGACCTTCGAAATTGATGAT
GAACACCGTATTCGTGTTTTCTTCGACAAGAGAATCGGTCAAGAAGTCGATGGTGAAGCC
GTTGGTGATGAATTCAAGGGCTACGTCTTCAAGATCTCTGGTGGTAACGACAAACAAGGT
TTCCCAATGAAGCAAGGTGTTTTGTTGCCAACTAGAATCAAGTTGTTGTTGACCAAGAAC
GTTTCTTGTTACAGACCAAGACGTGATGGTGAAAGAAAGAGAAAGTCCGTCAGAGGTGCC
ATTGTTGGTCCAGATTTGGCTGTCTTGGCTTTGGTCATTGTCAAGAAGGGTGAACAAGAA
TTGGAAGGTCTAACTGACACTACTGTTCCAAAGAGATTGGGTCCAAAGAGAGCTAACAAC
ATCAGAAAGTTCTTCGGTTTGTCCAAGGAAGATGACGTTCGTGATTTCGTCATCAGAAGA
GAAGTCACCAAGGGTGAAAAGACTTACACCAAGGCTCCAAAGATCCAAAGATTGGTTACT
CCTCAAAGATTGCAAAGAAAGAGACACCAAAGAGCTTTGAAGGTCAGAAACGCTCAAGCT
CAAAGAGAAGCTGCTGCCGAATACGCTCAATTGTTGGCTAAGAGATTGTCTGAAAGAAAG
GCTGAAAAGGCCGAAATCAGAAAGAGAAGAGCTTCTTCTTTGAAGGCTTAA
Promoter Sequence
Download FASTA
>RPS6B YBR181C
CCACTCCCAATCAAATGCTCGCCAGCAACATGTCCTCCCCTCTTTCTCGTTCAAAGTTTT
TGGGATTCAAGAACAATGATATGGACGACTTATATCATAATGGCCGATGTGGCAGCACTT
ATGTAAATAACAAAACATTCTTTCTGAAACCGCCAATTGGAAGACCGCCTAAATTTCCGA
AAAGCCCGTCTTCATCTATTGTGGTTTTTCCTTCCTCGGTAGCTAGTTCAACTTTGAAAT
CCACGAGTTCGACAAACTCTCCAGATTAATGAATCGCTTTCTAGCTACTTTTTACTACAA
GAAAGCATTCGCTTAAAATTAAGAGTGTATGTTGGCGCATTTAGGCAAACGTCTTCTAAA
TTAGGGCTATAGACAATTATGTCGCTCGTACATTTTTCAGATGTAGTGACGCAAATTTCT
AGCAATTTGCAGGTAGTGCTCCACGGCCCCCTTCCAATTTTTGTGCACTCAATCGATCAA
AACAATAGAGACTGCCCTGTTAACTTCTCAACATAATTATGTAAAAAATTATCTCATTAA
GCCAGATAGCAAATATATCACATATTGCATTGATTAATTTGAGAAAAATATACATGTATC
TTTTCAGTTAATTTTATTAAAAATAAATTATTTCCTTACTTTTTTTTCTACAGTTTGCAC
CATTAACCTCTTTTCTTGCATCCATACATCTTTGAACTCCATACATCTTATTTTTTTGCT
GTTTTTTTTCAGTGTCTCGGGCATACAGGCCGCTTATCTTCATGCCGGCCCATCATCCTA
GGAAACTCTTTCGGTATGGGCCAAGGGCAGGCGAAAATCCTATGTGCGTGGAGCTGATAC
AATCTCGGCTGGCTTGGTTTGTAGGGCACGGTCAATGAATGCCTGATGGGAGAAAAATTC
ATCTTTATGAAAAGTGATCTTAATTTGAATAGTGTGCCCTTCAAAACATTTGGAAGTCAT
TAATTGAAACTATCCAGTGTGAATAGACGACTGAGCCATC
Chr coordinates Chr II from 592416-591712,592774-592769
w3c xhtml validator w3c css validator