Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PCH2
Systematic Name YBR186W
Strain S288c
Description Nucleolar component of the pachytene checkpoint, which prevents chromosome segregation when recombination and chromosome synapsis are defective; also represses meiotic interhomolog recombination in the rDNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PCH2 YBR186W
GACAAATTTTTATGAGCAAATGACGTGTTTACATTGATATACGTCTCTATGGCTTTGTTT
TTCCAGAGTAAAAAAGAAGGTTTAATGCCTGATTGAAAACGAAACAATGCGACTTGAACA
GAGTTCAAACCAAACGTGTAAAGTCTTCTGATCAATGCATTTGCAACAATGAGAGGATGA
GCAAATACATTTGGAAGGTTCTTGTAAGCCGAGGGGATAAATATTTCGGCAGCAACACCC
AGGTGCCGAGGATTAAAATCTTGCTGCTTACTTTTATCTTTCTTCTTTGTAGTTTCACTT
TCTTTATTCAAAATTAACCTCGAAGTTGAAAATAATCGCCGCTTGTTAAATGATATCAAC
AAGGATCTTGGAGGGAAGAAAAGGCATGTAGATCTTAATACACTCATCTCATAAGCTTAG
CTGAATGGATAGGCTTGCTTTCTGATGGAAATTTGCCTTGCTTTTCCAACTATTCCATTA
CTCAGGTTTTATTTTTTTATTTTGTAATATGGGGAGAAGGCCGGCAGAATATTTACGGAC
AAATGAATAAATTGGATTGGATTGACTAGTGGAACGTGTAAAGATCGCGATACTCCGTAC
CAATCACCGAAAGATTGCCCGTAACCGAAATGACTCCATTCTCTGAATTTTTTGTGAAAC
CAATATCTGAGACTCTTCCTTCATCTTATCAACGTATTGTTCAGTCAATTAAGTAAGAAG
TATATTTGAGCGCAGCCTTAATCATATATAGCACCAGTTATATGTTTGCCCCTCTCTTGA
GTTGAAAAACACATAATACATAGTACTGTACTTTTCTCTTTTTCATCGTTGGCGAAAATA
TAATCTTTCTCAAAAATATATATATATGTATATATATCCTTAGATTTGCCGTTGACAATA
AGGTGGGCGGCAAATCTACGAAATGCGAGGCGGTTAAAAGAGAGTGACAACATTTTCATA
AAAATATTCTGATCTCAAACTGAAGACATAAAATAAGGAT
Chr coordinates Chr II from 600553-602103,602217-602360
w3c xhtml validator w3c css validator