Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HPC2
Systematic Name YBR215W
Strain S288c
Description Subunit of the HIR complex, a nucleosome assembly complex involved in regulation of histone gene transcription; mutants display synthetic defects with subunits of FACT, a complex that allows passage of RNA Pol II through nucleosomes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HPC2 YBR215W
AGTCATCGACAAACAAGGTAATTTGCTAGGTAACATATCGGTAACGGACGTAAAACATGT
CACAAGAACCTCCCAATACCCCTTACTACATAAGACATGTCGCCATTTCATTTCTGTCAT
TTTAAACTCCAGAGGATTAGAAACGGGTAAAGATTCTTTCCCCATTTTTCACGTATACCC
CAGTAGTTCACTAGCAAGGACTCTTGCCAAGTTAGTTGCTACAAAGTCTCATAGACTATG
GATCGTACAACCGCCGGAGTCGTCAACCTCGGCGTCATCCACAAATTTAACAGCTGCTAA
TACTGCAGCCAATGCAGTTTCTGCCACCGCTCAATCGTCTGCTAATGGTGCGACTCCAAT
GTCAAAGTCATCCTCTTCAACATCCCTCAACTCCCACTCTCCGTTGATGACAGCAATGGA
AGACCCACCATCCCCACGTTCTTCGGCCATCGCGATCCCACCACCAAGTCCCGCTTCCTC
AACAAACACACCAAACCTATTCGAAAAGGAATATAGAACGGGTAAGTTGATCGGTGTGGT
CTCATTGACAGACATCATCAACTTATTAGCAAGGAAACAAACAGGGAATAAAGAAGTGGA
TCCGCAATCCGCAAGAAGACAGAGAGGCAGTATCGCCATGTGAGGCTTGCAGCGTTGTCT
TTTCCCGCTGTTTCCCTCTCCCTCAAAAAAAAAAATCTTTTACAATGACTAAAAGAAAAT
ATTGTTCATTTATATGGTTTTAAGTATTTTGTAGACATTTAAGCGTATATACTTGTTCTG
AAAACATTTATATATTCTATTTTGTATATTCAACTTATTAAACTCTGACTTTTGCTATTG
TCGCGTATATGTATATCTTTTTTTCTTGTCGTGGAAAATTAAAGCAAAATATGTCAGGCG
AATGTACACACAATGCAGAAACTGATGCGGTTAATTTTGCATTCTGAAACGATTTAAACG
AACAGCATTAACCTCCACGACCATATTCAAACGATTGGAA
Chr coordinates Chr II from 653356-653368,653453-655317
w3c xhtml validator w3c css validator