Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SWC5
Systematic Name YBR231C
Alias AOR1
Strain S288c
Description Protein of unknown function, component of the SWR1 complex, which exchanges histone variant H2AZ (Htz1p) for chromatin-bound histone H2A
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWC5 YBR231C
CTGAAAGTTTAGCAATGTTTGACTAATGTAGAAAGTAGCAATATGGATAGCATCCGGAAC
CCCGTTAATGGTTAAAATTCTATCGTTAGAAAGCAGCAATTGATTCGGGGACGCGAATAA
TTTTGCTGCACTCAAATCCTCAATTTCTCTTAACCGAGACCCACGTTTGCCAATTATACA
TCCCATAAGATGATGAGGGATCAATAGGTTGATAGAAATCTCAATGTCTTCCCCGTTATC
TTCGTTACCATGTTCTTCAAGCAGCGCTCTTACTATCATGCCGTATGCCTTGGCTACATC
ATCGCAAGTACCCCTCACGTAAACAATTCTTTCAGGAACACCTCTGATATTATTTGATAT
GTTTATTCTAGCAGAGGTTTCGGATTTTATTCTAGATATAGTGGCGCCCTTGTGTCCTAC
TATCAGTGAAGCGTGTTTGACTAAGCACAGCATTCGTAAATGTACATCAGAGGGAACATT
GTCGGGGGAATCGTGGTCGTTGTCAGAGTGGCTGTCTGCATCCTTCAGGGCCACGCGTTT
GATTTCTGCTTCCAGTTGTTCCTCGCTGGTGTCTTCACCCTTTTTCCTTTTGAGCGTGTT
GGGAGAAACGAGTACAGTAGTTGGTGTAGTAGTGATTGATGGTTTTGTAGTCTCTGTGGA
CATAATTGAGCTAAAGAGTATTACAGAAAGATTATTTAATGCCGCGCTGGACGATTAAAA
TTGTTAGAGTGGATGTGGCTATGGATAAGTTTGAATATGAAAAAGGTTACTTATGCGGCT
AACGACTAGGTGCGTATTTATCGTTTGACGAGTATGTACGTGTTTTCTTTTGTATCATGA
TATTTCGTGTAAGTACCATATCGGGGAAAGACAAAAAAAAGTGAATTAAAGAGCGAAGTT
TAAAGATGATGAATAGGATTAATCGACAAGTAAGAAAAAAGACGAAAAGGCGTAAACTGG
AATAATATTGTTTCAAGAAAGAAAACCCACTAGCCTATAA
Chr coordinates Chr II from 683090-682179
w3c xhtml validator w3c css validator