Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRT2
Systematic Name YBR246W
Alias DPH7, ERE1
Strain S288c
Description Putative protein of unknown function; non-essential gene identified in a screen for mutants with increased levels of rDNA transcription; null mutants display a weak carboxypeptidase Y missorting/secretion phenotype
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRT2 YBR246W
TAATCTTCTTAAGGGGCGACTTTTCTCTTATAATAATTTCATAAGAAGCAATCACAACAT
CAAAGTCACAACCTAAAAGTTTTTTTTGGATCAGTTCAGCTCTTTCTTCTTTATCTCCTT
GCAAAATAAAGGCGTTTACGTCTGGCGTCCATCTATTTATTTCTCTCAGCCAATTATTTA
AGGTAGACTTAGGCGCAATGACTAAAAATGGACCTGGAATTTTTTCAATGTACCTAAGAT
ATCCCAGAAATGAAATAGTTTGCAGGGTCTTACCTAAACCCATTTCATCAGCAAGGATAC
CCGCTATTTTGTTCTTATGCAGAGACACCAACCAGTTGACACCTTGGATTTGATAAGGTC
TCAATTGACCATTAACGTAAGCAGGTGATTCTCTGAATTGGAATTCAATGCTCTCATCAT
CATCCGAGTCTTCTTCTTTCAATAATTCCGCATCTTCTTCGTGTTCAGTCTTTCGTCTAC
GAACATCTTGGTGTTTGCCTTTGCCTTTGCCATTTGCTTTATTTTCTTCTAATACATCTA
AGACCTGCCTGAATTTGGGATCTTTAGCGGCTTTACTTTCAATAAAATGCTTGAATAAAC
CACTCAAGGATAGCAGATGTTCAAATCTTTTTGTAGTGCCTTCCAGATCAAACTTTTTAC
CATTAGCATCCTTCAGCAGGTAACGTTTTTTATTCGATTCAGGATCATGTGGAGGGAGAC
CGACCTGGAACGGTTTTAAATTCTCCAAGTACTCTTCTGAAGCAGTCATAATTGAACCAG
ATGAAATACAATCGTATTTTTTTTTTTCTTGCAAAAATATGGCGAGAATAATTTTGAATA
GGTTCTCATCTTTGTCCTTTTCATTGCAAGAATTGTTTTCGTGTTTTTTTCTCATTCTAG
TATAGAACTTGAAAAAGTGAAAATTTGCAATAGCTAACATATAGGCCATAATAGGGTATT
TCTACATCCACCTCTAGCTGGTTTTTGCATAGCTATACAT
Chr coordinates Chr II from 711591-712754
w3c xhtml validator w3c css validator