Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO4
Systematic Name YBR249C
Strain S288c
Description 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase, catalyzes the first step in aromatic amino acid biosynthesis and is feedback-inhibited by tyrosine or high concentrations of phenylalanine or tryptophan
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARO4 YBR249C
TGTTGCAAGATAACAATACTGGCAAACATGGGCTTGAGTGCTTAGGAAGAAATCTTGAGG
TAGCAGTAACTTCTTTTTATTAAACAGTATGCAGCCGCCCAAAAAACTGCGATGTCGCCA
TTAGTTATTTTGTGACACAAAAACAAAATCGAAAACAAAAGAAATAGAAAGAAAAAGAAA
AAAACAAAGGCTAAACAAGATTCCATTGTGCAGATTTAATGTTTACAATATAATTACATT
CGCTCTTTTTGACCCCAGCTGCACAACCCACATAATTCGCATAAAACAATAACAATTGGC
CTAACATAGATGCCAAACACACTTCTGACATAACTGAATGCTAGGGTAAAACTCCACACA
GGTTTTTGAACACGAACTGCCAGTATACAGCTAGCCTTGAAAGTGATGGAAAACATTGTC
ATCGGCACATAAATAAAAAAATTATGAATCACGTGATCAACAGCAAATTATGTACTCGTA
TATATGCAAGCGCATTCCTTATATTGACACTCTTTCATTGGGCATGAGGCTGTGTAAACA
TAAGCTGTAACGGTCTCACGGAACACTGTGTAGTTGCATTACTGTCAGGCAGTTATGTTG
CTTAATATAAAGGCAAAGGCATGGCAGAATCACTTTAAAACGTGGCCCCACCCGCTGCAC
CCTGTGCATTTTGTACGTTACTGCGAAATGACTCAACGATGAAATGAAAAAATTTTGCTT
GAAATTTTGAAAAAAAGATGTGCGGGACGCATTGTTAGCTCATTGAATACATCGTGATCG
AATCCAATCAATGTTTAATTTCATATTAATACAGAAACTTTTTCTCATACTTTCTTCTTC
TTTTCATTGGTATATTATCTATATATCGTGTTAATTCCTCTTTCGTCATTTTTAGCATCG
TTATAAGAGTAATTAAGAATAACTAGAAGAGTCTCTCTTTATATTCGTTTATTTTATATA
TTTAACCGCTAAATTTAGTAAACAAAAGAATCTATCAGAA
Chr coordinates Chr II from 717994-716882
w3c xhtml validator w3c css validator