Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RGD1
Systematic Name YBR260C
Strain S288c
Description GTPase-activating protein (RhoGAP) for Rho3p and Rho4p, possibly involved in control of actin cytoskeleton organization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGD1 YBR260C
TCAGAAAAAATATCAAAAGAAAAATTTAATTATTAATCAGTACTTTTCACTCTGGTAATG
TGCATCGGTGTCAAGAGCATCTCCAAGAAAGAATACATAAACAACAACGATGGACGTGCC
TGCAGATTCCCATATCAAATACGAAGATGCCATCGACTATTGGACGGATGTGGACGCCAC
TGTGGATGGTGTTCTAGGTGGATACGGAGAAGGTACAGTAGTACCCACAATGGATGTCCT
GGGATCCAATAACTTCCTGCGTAAACTGAAGTCGAGGATGCTGCCTCAGGAGAACAACGT
GAAGTACGCTGTAGACATTGGTGCGGGGATTGGACGTGTAAGCAAGACCATGCTTCACAA
GCACGCCGCTAAGATAGACCTTGTAGAACCGGTAAAGCCTTTTATCGAGCAAATGCACGT
TGAATTGGCTGAGCTGAAAGACAAAGGCCAAATTGGACAAATATATGAAGTAGGGATGCA
GGACTGGACCCCCGATGCCGGCAAGTACTGGCTGATCTGGTGCCAATGGTGCGTGGGACA
CCTGCCAGATGCAGAACTCGTCGCATTCCTGAAAAGATGTATTGTTGGTTTGCAACCTAA
TGGGACAATCGTGGTCAAAGAAAATAACACACCTACAGATACCGATGATTTCGACGAAAC
GGATTCTTCGGTCACAAGGTCAGATGCTAAGTTCAGGCAAATCTTCGAAGAAGCTGGCCT
AAAGCTCATCGCCAGTGAAAGACAACGTGGCTTACCAAGAGAATTGTACCCAGTGAGGAT
GTACGCACTCAAGCCCATGCCAAACTAGGATCAAGGATGCATAGATTTATATAGATACGC
CCCTTTTCTTGTGCTGGCATTCACCATTTGTGCCATTATATAGACTTTTTTTTCGATATA
TATGGAAAAAGAACCCAGAAAATAAAGAATGTGAACAAAATAGTATGTAAAGTAAAAACA
TACAATCTCGGAAGATTAAAAGAGAAGTGATATAGACAAG
Chr coordinates Chr II from 734639-732639
w3c xhtml validator w3c css validator