Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TSC10
Systematic Name YBR265W
Strain S288c
Description 3-ketosphinganine reductase, catalyzes the second step in phytosphingosine synthesis, essential for growth in the absence of exogenous dihydrosphingosine or phytosphingosine, member of short chain dehydrogenase/reductase protein family
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>TSC10 YBR265W
ATGAAGTTTACGTTAGAAGACCAAGTTGTGTTGATCACTGGTGGTTCACAAGGTCTTGGA
AAGGAATTCGCCAAAAAATATTATAATGAGGCTGAAAACACAAAGATTATTATCGTCAGT
AGGTCAGAGGCTAGACTGCTGGACACATGCAACGAAATTAGGATTGAAGCTCACCTGAGA
AGGGAAACCACTGACGAGGGCCAAGTGCAACATAAGTTGGCTGCGCCCTTGGACCTTGAG
CAACGGTTATTTTACTACCCATGCGACTTGTCCTGCTACGAATCCGTGGAATGTTTGTTC
AATGCCCTGAGAGACTTGGATTTACTCCCTACACAAACGTTATGCTGTGCAGGGGGGGCT
GTTCCTAAGTTATTTCGTGGGCTAAGCGGACATGAGTTGAACTTGGGTATGGACATCAAC
TATAAAACAACTTTGAACGTGGCACATCAGATTGCCCTTGCAGAGCAAACCAAGGAACAC
CACCTCATCATCTTTTCTAGTGCCACCGCGCTTTACCCATTTGTGGGCTATTCCCAGTAT
GCGCCTGCAAAAGCTGCAATCAAATCACTGGTAGCAATCTTAAGACAAGAACTGACGAAC
TTCCGTATCAGTTGTGTTTATCCTGGTAATTTTGAAAGCGAAGGTTTCACTGTAGAGCAG
CTAACGAAACCCGAAATTACAAAGTTGATCGAAGGCCCCTCAGACGCTATCCCATGCAAA
CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT
TTTGTCGGATGGATGATAATGGGGATGGACCTTGGGCTCACCGCAAAGAAAAGCCGCTTT
GTTCCGTTGCAATGGATTTTTGGTGTCCTATCAAACATTCTGGTCGTGCCATTCTACATG
GTTGGCTGTTCCTGGTATATCAGGAAATGGTTTCGTGAAAATGACGGCAAGAAGGCCAAC
TGA
Promoter Sequence
Download FASTA
>TSC10 YBR265W
AAAATTTGAAAACTTTGGAACCAACAACGAAACTAGATGCAAGATCAAGACTCAATGAGT
TCAAGAAGTTGTGTAATGAATCTAGTGAAGTCGCTGCTTTGTCTGGCGAGATTTCCAAGT
GGGTCGGTCAATACCCTGTCCCAGGTGATATCTAAGTAATTATGATTTAAAATCAAATAC
TTTATGTATTAACATATACAGCCACTGCCGCTTTTTTTTTTATTTATTTCCAGTATATTT
CCCTGTTCATTGTTCTTTGACAATGTCTTGAATTGACTTTCGGGAACCAAACTGATTATT
ATTTTATTCAATGTATCGAAATTGTACCCTGTCTTTGCACTTACGGCCACATACGGCAGA
CCCTGTAACTCCGCCGGTATAGTCACTTCCCCTGAATGCTCTTCGCAGACTAAATCGTAC
TTATTGCCCACGATAATTACCTGCGTTCCCTGAGCACGGTCCTGTAAATCTTGAAACCAT
GTCTTTGCACATTGCAGACTGGATACGTCTCCCAATTCGAATACAATCAAAGCAATATTC
GCATCTCGATAATACATTGGCACCAGTGATTTATACCGTTCCTGACCCGCCGTGTCCCAT
ATCTCCATATGGATACGTTTCTCCGTAGAGGAGTCGTTAGAAGGAACCTCGATTGTCTTG
GTGATGAACGCCGCACCTATCGTAGCCGCATGTTTTGCTAGAAACTTACCTGATTTGAGC
CTAGTCACTATACTGGTTTTCCCCACTGATGAATCTCCTAGCAGTACCACTTTGATGGTT
GCTTCCATATCGTATTCCTCCGTATTTTGTGCTACTTGTATTTCCTGGAGTAATTTTACT
ATCATTGTTCCTTAACGTGAAACGTAAGGCTAAAAAACAATAAACGACAAAAAAAAAACA
AAAAAATGAAAAATGCAGAGGAGTTTCTCTGCATTTACTGGAAGCGATTAAATAAGATTG
CCTCAAGAAAAGAAGTTATCGGTATAATCTTTTGTAGGTA
Chr coordinates Chr II from 738582-739544
w3c xhtml validator w3c css validator