Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name REI1
Systematic Name YBR267W
Strain S288c
Description Cytoplasmic pre-60S factor; required for the correct recycling of shuttling factors Alb1, Arx1 and Tif6 at the end of the ribosomal large subunit biogenesis; involved in bud growth in the mitotic signaling network
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>REI1 YBR267W
CATGCGACTTGTCCTGCTACGAATCCGTGGAATGTTTGTTCAATGCCCTGAGAGACTTGG
ATTTACTCCCTACACAAACGTTATGCTGTGCAGGGGGGGCTGTTCCTAAGTTATTTCGTG
GGCTAAGCGGACATGAGTTGAACTTGGGTATGGACATCAACTATAAAACAACTTTGAACG
TGGCACATCAGATTGCCCTTGCAGAGCAAACCAAGGAACACCACCTCATCATCTTTTCTA
GTGCCACCGCGCTTTACCCATTTGTGGGCTATTCCCAGTATGCGCCTGCAAAAGCTGCAA
TCAAATCACTGGTAGCAATCTTAAGACAAGAACTGACGAACTTCCGTATCAGTTGTGTTT
ATCCTGGTAATTTTGAAAGCGAAGGTTTCACTGTAGAGCAGCTAACGAAACCCGAAATTA
CAAAGTTGATCGAAGGCCCCTCAGACGCTATCCCATGCAAACAAGCATGTGATATCATTG
CCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGATTTTGTCGGATGGATGATAA
TGGGGATGGACCTTGGGCTCACCGCAAAGAAAAGCCGCTTTGTTCCGTTGCAATGGATTT
TTGGTGTCCTATCAAACATTCTGGTCGTGCCATTCTACATGGTTGGCTGTTCCTGGTATA
TCAGGAAATGGTTTCGTGAAAATGACGGCAAGAAGGCCAACTGAGAGCACATCCACTCTC
ATTCCCGATATTCCCCGTGACTCTCTTTATTTCTTTCAAGACAAACCCTAGTGGTGTAGC
TATTTGTACATGTATAAGTATATACGAAATATTAATTATAACATTATTACCACGGCGATA
TTTTCCTATTTTTATTCTCTTTTCTTACTATATTTTGAAAGTTTTTCTTATGGGTACCGA
TGCGATGAGGTGAAAAAAATTTTCCTCTTTCCACTTTTAGTACAGGTTATGAGATGCTTC
TCATTAGAAGTCAAGAAGAGAGCATATCAGTAACAATACG
Chr coordinates Chr II from 739841-741022
w3c xhtml validator w3c css validator