Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBR287W
Systematic Name YBR287W
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the ER; YBR287W is not an essential gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBR287W YBR287W
TCAAGACCCAGAACATCATTGCCGACACAAAACACGGTGATCCTGATAATATTGTTGCCC
TTGGTGCTCATTCAGACTCTGTTGAGGAGGGCCCAGGTATCAACGACGATGGTTCCGGTA
CTATTTCCCTATTGAACGTCGCTAAGCAATTGACCCATTTCAAGATCAATAACAAGGTCC
GTTTTGCATGGTGGGCTGCTGAAGAAGAAGGTTTGCTAGGCTCTAACTTCTACGCTTATA
ACTTGACCAAAGAAGAAAACTCCAAGATCAGAGTATTTATGGACTATGACATGATGGCTT
CTCCAAACTATGAATACGAAATTTATGATGCGAACAACAAGGAGAACCCTAAGGGGTCTG
AAGAGTTGAAAAACCTGTACGTAGACTACTACAAGGCTCATCACTTGAACTACACTTTGG
TCCCATTTGACGGTAGATCCGATTATGTCGGGTTTATCAACAACGGAATTCCAGCCGGTG
GTATTGCCACTGGTGCCGAAAAGAATAACGTCAACAACGGAAAGGTCTTAGACAGATGCT
ACCATCAATTATGTGATGATGTCTCTAACTTATCCTGGGACGCATTCATTACCAACACCA
AGTTGATTGCTCACTCTGTGGCCACCTATGCTGACTCTTTCGAGGGTTTCCCAAAAAGAG
AAACCCAAAAGCACAAAGAGGTGGACATATTGAATGCTCAACAACCACAATTTAAGTACA
GGGCCGACTTCTTGATTATTTAAGTGTACTGTTCACATCAAGTATTTCTGTATAATTATC
TAAAAGAAAATAAAAACCCTCTTTTTTTTAACTGCACGTGCATCAAGGGGATCACAGCCT
CCTTATCAAAGTGAAAAAAAGGTAGAAAAAAAAACTGAAATTGTGATATAAAAGTTTAAA
CAGGAAATTATTGTAAATTGAACAATATGTGTGAAGCCCGTTTTTGGTTTGTTATTCCCA
ACTAACCATACCCTCATAGATTACTCTGCATTTCTACTAT
Chr coordinates Chr II from 776571-777854
w3c xhtml validator w3c css validator