Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUL1
Systematic Name YBR294W
Alias SFP2
Strain S288c
Description High affinity sulfate permease of the SulP anion transporter family; sulfate uptake is mediated by specific sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUL1 YBR294W
AAAGAAACTTATTGTTCAGCTTAGTGCAAACTCCTCATATATTGGATCTTTACATGGCGA
AGTTAAAAACACAGTCATAAAGAGTTTTGATGAGGCAACAAAGAGGGCTCATCTAATGTC
TACATTACTCTCTTCATTGGCCCTGATACTCTGCATCCTTAAAGACAATCTGGCGAAACC
TAAAACAAGAAGATAAACAATATATACCTATGCCCTTGACCGACTCAATTGATACATTAA
CAGTATTGAAACTAGATATTCTACTTGACACTAAACTTTTTTTGTATTTCGTGGAATTGC
AACGTTTCTAATTGACCGACAGTGCTGAACTGTGAGCGAATGCAACTATCTCTATAGTTT
TTTTATCCTCTGTAAACTTTAACTAAATACATACTACTTTCATAATCTGTGAATAAGATG
TGGCTGTGATAACCTAAAATAGTCACAAACCAATGAAAAAAGGCTTCAGAAAACTTGCTG
TAAAGTCCCCCCACTTTTTTGTGTTACCGCCACCTCGAGTGCACTTTTTTTAATAAAGAT
CTCGTGTAATTGTCCAAATCTGACTTTTTCTTATAGTCTCGCTGGAACCACAGTGCGGCT
TTGCAATTTTGCAAATCGGAATTTGAGTCACAGATCCCAGAAAAACTCCACACCTTCCCC
ACGCAGCAAGCGATAACGAACAAGTTGTCAAATTAGACCCATAATAATTTTGAACACTTC
TACCTGTTCATGTCTTTTCTCGAACACTGTCATTTGAAATTATGCACTGTGAAAAAAAGA
AACAAAGACCAAAAGAATAATATAAATAGTGAAGTAAAATGTGTTGTAATGCACATGGAT
CTTGTACTGCTCAAACTTAATATTTCTATTGTAGAAAAATTTTCGATTTAAAATTGTGAA
ACCGATTATATAAAAGTATATTAGCTGACATTAACGTCTCAAAACCAGGTCAATAGCTTT
AAAAATAAAAATAAATCCCTGCAGAATACTCGGAAAGAAT
Chr coordinates Chr II from 789235-791814
w3c xhtml validator w3c css validator