Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PCA1
Systematic Name YBR295W
Alias CAD2, PAY2
Strain S288c
Description Cadmium transporting P-type ATPase; may also have a role in copper and iron homeostasis; stabilized by Cd binding, which prevents ubiquitination; S288C and other lab strains contain a G970R mutation which eliminates Cd transport function
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PCA1 YBR295W
TGTTTTTAGTTATACATGAAAAGATAATTGTGTTATTAATGTAGATTACCATCAAATAGC
TGGAATATTTATTATTTTGAGTATGTTGAATGGCGAAAGTAAAAATAAATTTTATAATTT
CCTGAAAGCATTAGTACACGAAAAGGGCCGTTTTCAGTAGTTTAAGGCGCTGAAAAGACA
TGGTCTAGAAGTTAACTTGAGCTTGAGCCTATTTTCTACAAATGTCCTTTGAAAATACAA
AAATAAAAATAAAAATGCATTTAAGTATTAAGCTTATGCTAGATAGAGCAACATTTTCCT
AATTTTTTTTGAATTTATTTCATGGTTTTTAGGCGGAAAGAGTTTGGACGGCTTGTCTCT
CCTAATGTGGAAGAAATTATGTTTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCA
ATACAATGAATTTTAAAAAGTTACCCTGTACTTTAATCCTTCAATTAAAACACTTCTTAA
AATAGTATATTTTGAAGATCATCGATATATATACAGAGGCAGTTTTGCAAGGCAGATAAC
GTTATTGAGTTGTATGTAGGCTGTGTGATTTTAATCTCATAAATCAATAATGGAATAATT
TTCTTATTGTTAATATCGATTTATATTTTCCAACAATACAATGAAGTAAGTACTATTTCT
ATTTGGAAGGAATTCATTCCCCATTTTAGCTCCTCGAGCGGATGAATCCATCACTGTTTT
GAAGAAAACCAACAAAGTGTCAAATAGTTGTCTTTTTGAAATTGGTTCTGAAGAGTTTTC
GGAAAATGATCTGATAACAGGCCTTTCTAAAAATATAAGGTTGAACGAATGTATGGGTTA
GGTAATCAAAATTTAGGCGCCAACAAGGAATTTTTCTTTAAAATCGCATGAAAAGCCTAC
ACTTGGCATAAATAAGGTGCAATTATAAATATAAAAGCAAGATATTTTCGAGATGCTTCC
AGGATTTATACAATGAAAGAGCCCAAAGCTGCTGATAACG
Chr coordinates Chr II from 792849-796499
w3c xhtml validator w3c css validator