Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO89
Systematic Name YBR296C
Alias ITN1
Strain S288c
Description Na+/Pi cotransporter, active in early growth phase; similar to phosphate transporters of Neurospora crassa; transcription regulated by inorganic phosphate concentrations and Pho4p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO89 YBR296C
TATGGTTTGTTGAATTCACAGTACTCTCGTCAGCTTTGTCACGTATTCAACTGTAACCTC
TTTGAATCTCAACACTACGTTGTCTTCGCGTGTACTAAATGTATCGATTATATAATAGTA
TTTAAAAATCATTTAAAATTGCACCATGTACTGTATAATGATTTTCTCAAGACGATATTT
CGAGTTTTGCCGATGGGTCTTATAATCTCTTTTGATAGAGATACCTACTTTTAACAATAT
CAAAATTACTGATATAGGTTAATTTTTGTTCACGAGTAAGTACTTCAGTGACACTCGTCA
GTAAAGAACATTAGCGGAATCGTTATAATTTCATTCCTTACATCCGTTTAATTTCATTAA
TTCGATGCATCTTTCTTTGGCGAAGCCAGAAAATCTAGTTTCAGAAATCTCGGTTTCACC
CGCAAAAAAGTTTAAATTTCACAGATCGCGCCACACCGATCACAAAACGGCTTCACCACA
AGGGTGTGTGGCTGTGCGATAGACCTTTTTTTTCTTTTTCTGCTTTTTCGTCATCCCCAC
GTTGTGCCATTAATTTGTTAGTGGGCCCTTAAATGTCGAAATATTGCTAAAAATTGGCCC
GAGTCATTGAAAGGCTTTAAGAATATACCGTACAAAGGAGTTTATGTAATCTTAATAAAT
TGCATATGACAATGCAGCACGTGGGAGACAAATAGTAATAATACTAATCTATCAATACTA
GATGTCACAGCCACTTTGGATCCTTCTATTATGTAAATCATTAGATTAACTCAGTCAATA
GCAGATTTTTTTTACAATGTCTACTGGGTGGACATCTCCAAACAATTCATGTCACTAAGC
CCGGTTTTCGATATGAAGAAAATTATATATAAACCTGCTGAAGATGATCTTTACATTGAG
GTTATTTTACATGAATTGTCATAGAATGAGTGACATAGATCAAAGGTGAGAATACTGGAG
CGTATCTAATCGAATCAATATAAACAAAGATTAAGCAAAA
Chr coordinates Chr II from 798522-796798
w3c xhtml validator w3c css validator