Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LEU2
Systematic Name YCL018W
Strain S288c
Description Beta-isopropylmalate dehydrogenase (IMDH), catalyzes the third step in the leucine biosynthesis pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LEU2 YCL018W
ACATCGAGACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCTTCCGATAAAAACAT
TTAAACTATTAACTAACAAATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGG
AATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATAC
GGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAAC
GCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATAATAAT
ATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAG
AACTTCTAGTATATCTACATACCTAATATTATTGCCTTATTAAAAATGGAATCCCAACAA
TTACATCAAAATCCACATTCTCTTCAAAATCAATTGTCCTGTACTTCCTTGTTCATGTGT
GTTCAAAAACGTTATATTTATAGGATAATTATACTCTATTTCTCAACAAGTAATTGGTTG
TTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGAAATATCTTGACCGCAGTTAACTGTGG
GAATACTCAGGTATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCATTATTTTTTTC
CTCAACATAACGAGAACACACAGGGGCGCTATCGCACAGAATCAAATTCGATGACTGGAA
ATTTTTTGTTAATTTCAGAGGTCGCCTGACGCATATACCTTTTTCAACTGAAAAATTGGG
AGAAAAAGGAAAGGTGAGAGCGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCA
TGACTAAATGCTTGCATCACAATACTTGAAGTTGACAATATTATTTAAGGACCTATTGTT
TTTTCCAATAGGTGGTTAGCAATCGTCTTACTTTCTAACTTTTCTTACCTTTTACATTTC
AGCAATATATATATATATATTTCAAGGATATACCATTCTA
Chr coordinates Chr III from 91324-92418
w3c xhtml validator w3c css validator