Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LEU2
Systematic Name YCL018W
Strain S288c
Description Beta-isopropylmalate dehydrogenase (IMDH), catalyzes the third step in the leucine biosynthesis pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>LEU2 YCL018W
ATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGAAATCACA
GCCGAAGCCATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGAT
TTCGAAAATCATTTAATTGGTGGTGCTGCTATCGATGCTACAGGTGTTCCACTTCCAGAT
GAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCCGTTTTGTTAGGTGCTGTGGGTGGTCCT
AAATGGGGTACCGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTT
CAATTGTACGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCT
CCAATCAAGCCACAATTTGCTAAAGGTACTGACTTCGTTGTTGTCAGAGAATTAGTGGGA
GGTATTTACTTTGGTAAGAGAAAGGAAGACGATGGTGATGGTGTCGCTTGGGATAGTGAA
CAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAA
CATGAGCCACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGA
TTATGGAGAAAAACTGTGGAGGAAACCATCAAGAACGAATTCCCTACATTGAAGGTTCAA
CATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCTAAATGGT
ATTATAATCACCAGCAACATGTTTGGTGATATCATCTCCGATGAAGCCTCCGTTATCCCA
GGTTCCTTGGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCA
TTTGGTTTGTACGAACCATGCCACGGTTCTGCTCCAGATTTGCCAAAGAATAAGGTCAAC
CCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAAATTGTCATTGAACTTGCCTGAA
GAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGT
GATTTAGGTGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAG
AAAATCCTTGCTTAA
Promoter Sequence
Download FASTA
>LEU2 YCL018W
ACATCGAGACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCTTCCGATAAAAACAT
TTAAACTATTAACTAACAAATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGG
AATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATAC
GGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAAC
GCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATAATAAT
ATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAG
AACTTCTAGTATATCTACATACCTAATATTATTGCCTTATTAAAAATGGAATCCCAACAA
TTACATCAAAATCCACATTCTCTTCAAAATCAATTGTCCTGTACTTCCTTGTTCATGTGT
GTTCAAAAACGTTATATTTATAGGATAATTATACTCTATTTCTCAACAAGTAATTGGTTG
TTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGAAATATCTTGACCGCAGTTAACTGTGG
GAATACTCAGGTATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCATTATTTTTTTC
CTCAACATAACGAGAACACACAGGGGCGCTATCGCACAGAATCAAATTCGATGACTGGAA
ATTTTTTGTTAATTTCAGAGGTCGCCTGACGCATATACCTTTTTCAACTGAAAAATTGGG
AGAAAAAGGAAAGGTGAGAGCGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCA
TGACTAAATGCTTGCATCACAATACTTGAAGTTGACAATATTATTTAAGGACCTATTGTT
TTTTCCAATAGGTGGTTAGCAATCGTCTTACTTTCTAACTTTTCTTACCTTTTACATTTC
AGCAATATATATATATATATTTCAAGGATATACCATTCTA
Chr coordinates Chr III from 91324-92418
w3c xhtml validator w3c css validator