Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRM2
Systematic Name YCL026C-A
Alias YCLX08C
Strain S288c
Description Protein of unknown function, involved in the integration of lipid signaling pathways with cellular homeostasis; expression induced in cells treated with the mycotoxin patulin; has similarity to bacterial nitroreductases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRM2 YCL026C-A
GGTCGCTATCGCCCCCATTGGTGAAGGTAAGCTGGATGCACAAGCCTTTTTCGAAAACTA
CTTGGCTATGCCAATCTTGATTGCACTTTATGTCGGCTACAAGGTCTGGCACAAGGATTG
GAAACTGTTCATCAGGGCAGACAAGATCGACCTAGATTCTCATAGACAAATCTTTGATGA
AGAATTAATCAAGCAAGAAGACGAAGAATATAGGGAACGTTTGAGGAACGGACCTTATTG
GAAAAGGGTCGTTGCCTTCTGGTGTTAAAAAAAAAAGCATTTACTTCTTTTATATTTATT
CATTTTTGTACTTCTGTTTTGTAGTAATAGCATACGTGTAATGATAGACGATTTTCATTT
TAATTCTAGTCCTTTATGAGCGAAGAAAAAAAATAAAAAGCACTAACGATTGCGTGATGG
AAGTGGAGAGGAAAATATAAGTGAAATAATATGAAGTGAGAGAAAAATGATTTCCTTTTG
TTCTTAATGCAACAGAAGAGGTTTGATTTCATCCGCATATGCAATTTTGCCTTAGTAGGG
GTGCAACCGTTTTCGTCGTGCATCAGGAACGATCTTCTTGCCTTTTTTAAAAATCTACGT
TAAGAATTTTTAATTTTGTTAAGGTGTAATTAGCATTAGAATGACTGAAGCATTCAGTTT
AACCAACTTGTTCTGCGATATTTTTACTTCTGAAATAACAATGTCTGCGAGTGTTACTTG
ATTATTAATCAATATTTGTCAATGCTCTTCCGAATAATTTTTCAATTTGTCAGCTTTGCT
CTGCGCTTTTCCTTACTGCGACAATAAATGGCAAAGGAAAAAAAAATACAGTGTCATTTG
CAGATATGACACACTTTAACACCTGAGTGGGTCATCACTACTTTGTGTTTGTCTCCACCC
ATGTTGTGATCGAAGAGAGATATAAAGGTTGATCATTTTTGGTTTTTTAAAGCTATATAC
ACCATCAAAATCAAGAACACCAGACCTCCAAGCCAAAGAA
Chr coordinates Chr III from 75285-74704
w3c xhtml validator w3c css validator