Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FUS1
Systematic Name YCL027W
Strain S288c
Description Membrane protein localized to the shmoo tip, required for cell fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FUS1 YCL027W
TAATAATCAGAACTCCAACAATAGTCAACAGGGCTATAACCAATCCTATCAAAACGGTAA
CCAAAATAGTCAAGGTTACAATAATCAACAGTACCAAGGTGGCAACGGTGGTTACCAACA
ACAACAGGGACAATCTGGTGGTGCTTTTTCCTCATTGGCCTCCATGGCTCAATCTTACTT
AGGTGGTGGACAAACTCAATCCAACCAACAGCAATACAATCAACAAGGCCAAAACAACCA
GCAGCAATACCAGCAACAAGGCCAAAACTATCAGCATCAACAACAGGGTCAGCAGCAGCA
ACAAGGCCACTCCAGTTCATTCTCAGCTTTGGCTTCCATGGCAAGTTCCTACCTGGGCAA
TAACTCCAATTCAAATTCGAGTTATGGGGGCCAGCAACAGGCTAATGAGTATGGTAGACC
GCAACAGAATGGTCAACAGCAATCCAATGAGTACGGAAGACCGCAATACGGCGGAAACCA
GAACTCCAATGGACAGCACGAATCCTTCAATTTTTCTGGCAACTTTTCTCAACAGAACAA
TAACGGCAACCAGAACCGCTACTGAACGATGATTCAGTTCGCCTTCTATCCTTTGTTTAC
GTATTTGTTTATATATATAACTTTATTTTTTTTTATTAATTGGGCTGCAAGACAATTTTG
TTGTCAGTGATGCCTCAATCCTTCTTTTGCTTCCATATTTACCATGTGGACCCTTTCAAA
ACAGAGTTGTATCTCTGCAGGATGCCCTTTTTGACGTATTGAATGGCATAATTGCACTGT
CACTTTTCGCGCTGTCTCATTTTGGTGCGATGATGAAACAAACATGAAACGTCTGTAATT
TGAAACAAATAACGTAATTCTCGGGATTGGTTTTATTTAAATGACAATGTAAGAGTGGCT
TTGTAAGGTATGTGTTGCTCTTAAAATATTTGGATACGACATCCTTTATCTTTTTTCCTT
TAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATCAAA
Chr coordinates Chr III from 71803-73341
w3c xhtml validator w3c css validator