Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIS4
Systematic Name YCL030C
Strain S288c
Description Multifunctional enzyme containing phosphoribosyl-ATP pyrophosphatase, phosphoribosyl-AMP cyclohydrolase, and histidinol dehydrogenase activities; catalyzes the second, third, ninth and tenth steps in histidine biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HIS4 YCL030C
GAATTACGAGAAGCCCAATTGACCATCGAAAAGCTACAAAGGAAACAACTACACTACAAA
AGGCTACTCGATGACCAAAGAATGGTCCTCGAAGAAGTGCAACCGACTTTTGATAGGTAT
GAAGCCACAATACAAGAAAGAGAGAAAGAGATAGACCATCTCAAGCAACAATTGGAGCTC
GAACGCAGACAGCAAGCCAAACAAAAGCAGTTTTTTGACGCTGAGAATGAACAGCTACTT
GCTGTCGTAAGCCAACTACACGAAGAGATCAAAGAAAACGAAGAGAGAAATCTTTCTCAT
AATCAACCCACTGGTGCCAACGAAGATGTCGAACTCCTGAAAAAACAGCTGGAACAATTA
CGCAACATAGAAGACCAATTTGAGTTACACAAGACAAAGTGGGCTAAAGAACGCGAACAA
TTGAAAATGCATAACGATTCGCTCAGTAAAGAATACCAAAATTTGAGCAAGGAACTATTT
TTGACAAAACCACAAGATTCCTCATCGGAAGAGGTGGCATCCTTAACGAAAAAACTTGAA
GAGGCTAATGAAAAAATCAAACAGTTGGAACAGGCTCAAGCACAAACAGCCGTGGAATCG
TTGCCAATTTTCGACCCCCCTGCACCAGTCGATACCACGGCAGGAAGACAACAGTGGTGT
GAGCATTGCGATACGATGGGTCATAATACAGCAGAATGCCCCCATCACAATCCTGACAAC
CAGCAGTTCTTCTAGGCAGTCGAACTGACTCTAATAGTGACTCCGGTAAATTAGTTAATT
AATTGCTAAACCCATGCACAGTGACTCACGTTTTTTTATCAGTCATTCGATATAGAAGGT
AAGAAAAGGATATGACTATGAACAGTAGTATACTGTGTATATAATAGATATGGAACGTTA
TATTCACCTCCGATGTGTGTTGTACATACATAAAAATATCATAGCACAACTGCGCTGTGT
AATAGTAATACAATAGTTTACAAAATTTTTTTTCTGAATA
Chr coordinates Chr III from 68333-65934
w3c xhtml validator w3c css validator