Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG22
Systematic Name YCL038C
Alias AUT4
Strain S288c
Description Vacuolar integral membrane protein required for efflux of amino acids; required for efflux of amino acids during autophagic body breakdown in the vacuole; null mutation causes a gradual loss of viability during starvation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG22 YCL038C
ACTGGTCGGCGATGCATTGGACCAATTCATGATATCCCTACCACCTGTTCCTCAACAAGA
AGAGGAATCATCCACTGAACTCGCTTCTCAAGAACAAGAAACCAAAGAAGACTCTGCGCC
GGTTGCTGCCGGTGAATCCGAGTCTTCCTTATAAAGGCCTCTCACACTTGCAAAATAAAA
AATGGATTCGTTCATTGCATTTTACACAAAAAACCATAAAAAATTGAAAAACCTAATAAT
TAAAAAAATTAAAAGTTAATCATCCTCCAGCAAAGCTGTTTTTTTTTTGTTTTTTTTTTT
TTTTTTGTTTTTTTATCCATTTTTTTCATTTGTTCCATCAGTTTAATACGAAAGAGAAAA
TAAAAATAAAAACTTTGAACAATTTTCATGTTTTGAATTCATTGTACATTATCATCATAA
GCAATAAGATACAAATATTTATGTTTTTTTTTTTTTGTTTTTTTTTTTTTTTAAGATATA
AAAATACTAGCCTCTTCTCACTTCGTTTTCTCTCTGTCTAAGTGGCTACCATCATGAGAT
ATGATATTCTTTCTTCTCCCTGCGCAATTCTTAAACCACCTGCTTTTTTTATTCAATTTT
TTGCTAATTTAATAATTGGGAAGAAGATATGAAAAATGCCTATTTTACTCTAAGCAATTC
ATATGTAAAAAATTTTATGTATAGTTTTTTTTTTCTCTTTTGTGCTGTCAAATTCCTTTT
TATTGTCATCTAAGACCATGCTTTAGCTTCTGTCATGTATAATGCAACGTGTCTTAGATT
ATTAATTGTTGTATTGTGCGGCATTGATAGCGCCGCTCAACAATTTTAGGAAATTGCTAA
AATTAATTCCTTAAAACGGTATTTTCCTAAACGAAAATACCTCAGCTATTGAAAGATGCG
TAGTGTAAACAAAAGGAAAGATTTCAAACTGTACCTATATTACCACGGTTTTTGCCCTTA
TAAGCAATAGTTTGCTCATAACATATTCTCTACATTAGAT
Chr coordinates Chr III from 56527-54941
w3c xhtml validator w3c css validator