Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GLK1
Systematic Name YCL040W
Alias glucokinase, HOR3
Strain S288c
Description Glucokinase; catalyzes the phosphorylation of glucose at C6 in the first irreversible step of glucose metabolism; one of three glucose phosphorylating enzymes; expression regulated by non-fermentable carbon sources; GLK1 has a paralog, EMI2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLK1 YCL040W
GGCAGTTCTAGGTCCCTCGTAATCGATCGAGTTGTTAACATCGCTGTTTTTGAAAATCTT
CAAGCTTGGGAACCCTGGAATGTTGTGTTCCATACACAGATCCTGGTTTTCAGTACAGTC
GATCTGGGCCAAGGTAATGTTTTTCTCAACTAAAGTCTCGGCGGCTTTAACGTATTCAGG
AGCCATGTTCTTACAGTGGCCACACCATGGAGCAAAAAACTCCGCAAGCACCAAGTCGTG
CGACTGAATGTACTCATTGAAGGAGTCGGTGGCCAACTTAACGACAGCGGAGTCTTCAGG
GGCCACAGCCTCTTGTTGGGCGAAAACAGAGGAGGCGAGCAGCAGGGAGGACCATGACAG
GACGGCACCAGCAGAAAACTTCATAACGGGATAGATGTATGTTTTTCTTTATGTAGAGCT
TGGCAGCTTTAAAATTACCAATTAGACATGCTGCTTGCAACAAGAAAATGCACGCGTAAC
AAAATATATATATATATATATATATATATGTATGTCCATACGGGTTTTTCGTTTTGTTGT
GGTTGTAACAGCACAACAAAATGCTACACGGTGGCAAATTGGAAAAAGAGACTAGTGAGA
GAAAAGGGAAAAAGAGGCGCCGCCCGACAGGGTAACATATTATCACGTGCAGCCCAGGAT
AATTTTCAGGACACGTGTTTCGAAAGGTTTGTCGCTCCGAAAAAATCAAAAAAAACAAAA
AACGGGAAATAACAATAACGACAAAAATGGAAAAAAAAAAAATTTTAGACGCGGCGCTTG
CACCCCGCATTATAAGTGGTGTGCCGACGGACGGTCAACCCCTTTCAGGGGGCCCCCTAT
CTTGGGCGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAACGCGCCCATATA
AATATCCGCTATCAACAGAACCCCCAACCCCCCCATCAGTGCCCAACTCAGCTTCCGTAA
ACCACAACACCACCACTAATACAACTCTATCATACACAAG
Chr coordinates Chr III from 50838-52340
w3c xhtml validator w3c css validator