Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPS22
Systematic Name YCL048W
Strain S288c
Description Protein of unknown function, redundant with Sps2p for the organization of the beta-glucan layer of the spore wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPS22 YCL048W
ACAAGTGTGGTTCTTGCCTCTAAGATTTACATTGCCTTTTCCCAAAGGGAAGGTGGGACA
AAACTCATTTTCCCTAAGGGGAAACGTAAGATACCCTTTAGGGAAGATAAGGGAAGTTAG
TAGATTGACGACGTAAATCTGTGATGAGATGAAAAAAAAAGATTAGCATCTATATAAGAA
AGTACATAACCTCCATTTAAGTTGAAAAAAATTTGTATGTAATGTCTTTTCTTCCTCTTT
TCTTTATTTCATTCTCACCGCTAAATCGATAACGGCTAAAACAATTAAAGCTCCCTTTTC
AAACCTTATACTTCCGTTAAATAATGCAAATCAAAAACATTGTCGCTGTTCTAGCTACAG
TCACTGCTATCAACGCCCAAGTTGGCATTGAACCTAACGCCACTACTCCAAATGCTACGC
AGCCAAATGCTACGCAGCCAAATACTACTCTTCCTACCGCTTCGGTGACTACGACAGTTT
CGATTGGCGAAGCCGTAGTTAATACCATGGCGGCGGGTGCCTTTGGAGCAGCAATCGCTG
CCGGTGTTGCCTTCTTATTCTAGGAACATTTTTATTTCCTTTATTTTTTTCTTTCTTTCT
AATTCCATAACCGTTGTTCAAAATTGGGGAGCTTTTTAACTTTCGTTCCATTAAGCTTTT
TCTTTGTTCTTTACGTTTGATTCTATTTCAACCATAATTTATTTTTTCGTTATTTAATAA
TTACTAATATTTAATACTAGATGTATATACGTTGTGTGTATGCGCTACTATAGTATAGCT
TAACTGTTTTATTATACCCTTTTTTTCTCTCTTTACTGTACAGAAGATGCGTCACTAATT
CAAAAAAAAAAAAAAAAAAAAAAATATAAAAAAGAAAGATTTTGGAGAAGCTATATCCTT
TTGTGACATACAATAGAGAAACTTGTTCTGTTGGTAAGATATCTCATCTGAAATACAACA
AGGAAAACCAAAAGCCATTTTTTCATTACTTGATCGACTT
Chr coordinates Chr III from 42165-43556
w3c xhtml validator w3c css validator