Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRD1
Systematic Name YCL057W
Alias metalloendopeptidase
Strain S288c
Description Zinc metalloendopeptidase; found in the cytoplasm and intermembrane space of mitochondria; with Cym1p, involved in degradation of mitochondrial proteins and of presequence peptides cleaved from imported proteins; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRD1 YCL057W
CAGCTAAACTGAAAGCTGAGACTACTTTGAAAGCCGAGGAGCTGATCAAGGACCAGGAAA
AGGACTCCAAGGTACGAGAGCAAATTCGGACAGAAAAATCAAAAACAAACGACAGCATGC
TGAAGCAGATCGAAATGATATCCGGCTTTTCCTTATAGGGAATAGTGGTGAAAGTTACGT
AAATATATACATATAGAGCGGAATGGTACTGCATATTTTTATTATTTTTTTTTTTGAATA
TATATAAAGCATCGTCGCTTAAGACTAAACCTTCGAGGATCTGAGGCCAGCGCTGGATCT
AAAGATGGCGTCGCCCTCGGCGTAGCCTCTTCCAACACCAAATCCAATGCCTAGCCATAC
AGGAAATGCACGGCGCTTGAAGAATAATACTGAGGTGAACACACCCACGCCAAAACCCAT
GGCAGTCTTGACCAGCATGTTGGACAGGACAATATCCCACTTAGTGTCGAGGATCGTGGA
CACGGAGCTGCCATTCTTGTTAGAATCCTTGGAGGGAGTGCTTTTCGCTGGTTGTTGTGT
TTGTGCTTGTTCGGACATGGTATATTTTGTCTTTTTCCGTGTTTATTCCCTCTCGTAGCA
AAGTTAATCTGCCAATTGACAGTAGTTTAATATATGGTATTATCGTTGTTTGAAGCCCTT
TAAAAGGAAAAAACGGGTTAGGGCCACCCGGCGCGAAGTAATAGCTGCTGATTGGTCAGA
ATAGTAAAACGGCTTGAATTGATAGTATATCGTACTGTATATACCTTATATTTGGGCTAA
TAATCATCTCCCAAATGCTCCAGTATACATGTCACCTAGCTATGTATGAGGTTGACTACC
TTATATGCAGCTACTACACAATAACTGTAGTATCGCGCTGCACGAGCGTGACGGCGGTTA
AATCTGGATTTTTTGCCACCTTTTTTATACGAAAATAAGAACTAGGTAAATAGGAAGGAA
TGGTTGGATTTGAGTTTAAAAATAGAGGGAATACTTGGAG
Chr coordinates Chr III from 24768-26906
w3c xhtml validator w3c css validator