Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADF1
Systematic Name YCL058W-A
Strain S288c
Description Transcriptional repressor encoded by the antisense strand of the FYV5 gene; negatively regulates transcription of FYV5 by binding to the promoter on the sense strand
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADF1 YCL058W-A
TTTCAATTTCCAAATCAACCTTTCTAGGCAATTGGGCAGGAGGAAATGGAGTATAGACCT
TCTTTTCGACGTTTCTGATCTTCTTGGGTTTCTTTCTGGCCACATTCCTCTTCTTAAACA
TGGGCAAGAATCTTGACCAATCTTCATTGGCTAACTCTGGCCTTTTTGCCAATTCTCTTT
TTATCATTAATTCCTTGATATGATAGATAGGGTGAATATTTTTCATACAATCTTCTACTA
CTCGACGGACCTCCTTCAAGCCCTTGAAGGGACCCATGGCACTTACTGTGTTACCTTGTA
CTAGAATGTAACATTTAGTTAGAAGTTCCAAAGCCTTTAAAGTATTACCGTTAGGGCCTA
CAAGACGTTGTCTTCTCTTGACAAACCTTTCTTTGTTAGTAACGAAATTACCAATTTTAA
TAACGTCGCATGCCATGTCATCTTGTAGGATCTTAACGGCTTGCGGGAAAGGAACGGATC
TCGCCAATAATTTGATCAAATCTCTGGCTTTCAAAATGATAGCGGGATCGTATGTTTTTC
TAGTTGTTTTTACTGTCATAGAACCTTCGACTAAATCTAGAACACACGCTATGTTGTGTT
TGTCTAGAGCCCTTGTTACATCATTCCAAATCGTCTTCAAGTAACTTTCTCTGTATTTAG
GAAACAAAGTCATAAAACTGGACTCTTCAGCAAAAGGTTGACCGGATGCGTTATCCTCTT
CCTTAAACTCCTCTATCTTCCATTTATCAATATCATCCGTATCCCAAGGTTTATCTCTGT
TATGTGTAGACACCATCGTTTGCCAATTTGGATATTTGTGTGACCCTTTTGTTTGCTGTC
TACTTTACAATAGTTAACCTCATCATCTCTTTTTTTTGAAAATTTTCATATCTCATCGCT
AAAAGAATTAGAAATATAAGGAAAAAAAAATTTTCGTTTTCAGATGTGCAAGCCTGCTAT
AATAAGGTACAATAACTCAAGGGCATTTAGCAAGGAAAAA
Chr coordinates Chr III from 23584-23925
w3c xhtml validator w3c css validator