Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CHA1
Systematic Name YCL064C
Strain S288c
Description Catabolic L-serine (L-threonine) deaminase, catalyzes the degradation of both L-serine and L-threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CHA1 YCL064C
AGTATCATGTGATTTGGCTGCACGTAAAGTGCGATTTCTTGCAGGTTGTTTTTTAGGTGA
GCACGGTAAAGAGTTAGTTTTCGAAGGACAATCGACTTCATTGATGGGGTTAAAGCCTAC
CGATTTTTTTGGTGGTTTCGATGGAGTTACCATACACAGACGTTGCCTCTCAATTATTTT
CAATGGTCGAGGTTGAAATGACCCTAAACTACTTCTGGTGGATTGCGATTGTGGAGAATC
ATTAGGCGCTTCATTTGGGACGGTGGCCAGCTCGTTCAACCTCAAAGTGATATCCTGGAA
TTCACGAACCAAGTCTTCTATGCGTTGATGCTCATTATCCTCTGTGATCAATCTGCGTTG
TTGTTCCTTGCTCAACTTGTCTCGAACAGATTCCGATCTAACATACAAAGAGTTCAGTTG
AGACATATACTGGTTGTACTGTTGGGATAACTTATCCAATGACTCTTGATCTGTTGTCTG
GCATATTGATGATCTCTGCTGACGTTGTATCCACAGATCTAATTGCAAGATAGCCTCTTG
CGACCTTATTAAAAGCCTCTCCGTGATATCCTCTAGGGCTTGGGTTGCCATTAATCGATG
TGTCCTTGTTTCCTTATGCGAGCTGTTTCTTATCTATCTTATGGTCCCATTCTTTACTGC
ACTGTTTACATTTTGATCAATTGCGAAATGTTCCTACTATTTTTCTTTTTCTCTTTTCGC
GAGTACTAATCACCGCGAACGGAAACTAATGAGTCCTCTGCGCGGAGACATGATTCCGCA
TGGGCGGCTCCTGTTAAGCCCCAGCGGAAATGTAATTCCACTGAGTGTCATTAAATAGTG
CCAAAGCTTTATCAAATTGTTTGCGATGAGATAAGATAAAAGGGACAATATGAGGAGGAA
CACAGGTATATAAATATCGCCAAATAAAAGGAAAATGTTTATACAGTTTTCTCTTTTTTA
AGTGCTGGATAGACAAGAGACAGGAAAATTAACCAGCGAG
Chr coordinates Chr III from 16880-15798
w3c xhtml validator w3c css validator