Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CHA1
Systematic Name YCL064C
Strain S288c
Description Catabolic L-serine (L-threonine) deaminase, catalyzes the degradation of both L-serine and L-threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>CHA1 YCL064C
ATGTCGATAGTCTACAATAAAACACCATTATTACGTCAATTCTTCCCCGGAAAGGCTTCT
GCACAATTTTTCTTGAAATATGAATGCCTTCAACCAAGTGGCTCCTTCAAAAGTAGAGGA
ATCGGTAATCTCATCATGAAAAGTGCCATTCGAATTCAAAAGGACGGTAAAAGATCTCCT
CAGGTTTTCGCTAGTTCTGGCGGTAATGCCGGTTTTGCTGCTGCAACAGCATGTCAAAGA
CTGTCTCTACCATGTACAGTCGTGGTTCCTACAGCGACAAAGAAGAGAATGGTAGATAAA
ATCAGGAACACCGGTGCCCAGGTTATCGTGAGTGGTGCCTACTGGAAAGAAGCAGATACT
TTTTTAAAAACAAATGTCATGAATAAAATAGACTCTCAGGTCATTGAGCCCATTTATGTT
CATCCCTTCGATAATCCGGATATTTGGGAAGGACATTCATCTATGATAGATGAAATAGTA
CAAGATTTGAAATCGCAACATATTTCCGTGAATAAGGTTAAAGGCATAGTATGCAGCGTT
GGTGGAGGTGGTTTATACAATGGTATTATTCAAGGTTTGGAAAGGTATGGTTTAGCTGAT
AGGATCCCTATTGTGGGGGTGGAAACGAATGGATGTCATGTTTTCAATACTTCTTTGAAA
ATAGGCCAACCAGTTCAATTCAAGAAGATAACAAGTATTGCTACTTCTCTAGGAACGGCC
GTGATCTCTAATCAAACTTTCGAATACGCTCGCAAATACAACACCAGATCCGTTGTAATA
GAGGACAAAGATGTTATTGAAACCTGTCTTAAATATACACATCAATTCAATATGGTGATT
GAACCGGCATGTGGCGCCGCATTGCATTTGGGTTACAACACTAAGATCCTAGAAAATGCA
CTGGGCTCAAAATTAGCTGCGGATGACATTGTGATAATTATTGCTTGTGGCGGCTCCTCT
AATACTATAAAGGACTTGGAAGAAGCGTTGGATAGCATGAGAAAAAAAGACACTCCTGTA
ATAGAAGTCGCTGACAATTTCATATTTCCAGAAAAAAATATTGTGAATTTAAAAAGTGCT
TGA
Promoter Sequence
Download FASTA
>CHA1 YCL064C
AGTATCATGTGATTTGGCTGCACGTAAAGTGCGATTTCTTGCAGGTTGTTTTTTAGGTGA
GCACGGTAAAGAGTTAGTTTTCGAAGGACAATCGACTTCATTGATGGGGTTAAAGCCTAC
CGATTTTTTTGGTGGTTTCGATGGAGTTACCATACACAGACGTTGCCTCTCAATTATTTT
CAATGGTCGAGGTTGAAATGACCCTAAACTACTTCTGGTGGATTGCGATTGTGGAGAATC
ATTAGGCGCTTCATTTGGGACGGTGGCCAGCTCGTTCAACCTCAAAGTGATATCCTGGAA
TTCACGAACCAAGTCTTCTATGCGTTGATGCTCATTATCCTCTGTGATCAATCTGCGTTG
TTGTTCCTTGCTCAACTTGTCTCGAACAGATTCCGATCTAACATACAAAGAGTTCAGTTG
AGACATATACTGGTTGTACTGTTGGGATAACTTATCCAATGACTCTTGATCTGTTGTCTG
GCATATTGATGATCTCTGCTGACGTTGTATCCACAGATCTAATTGCAAGATAGCCTCTTG
CGACCTTATTAAAAGCCTCTCCGTGATATCCTCTAGGGCTTGGGTTGCCATTAATCGATG
TGTCCTTGTTTCCTTATGCGAGCTGTTTCTTATCTATCTTATGGTCCCATTCTTTACTGC
ACTGTTTACATTTTGATCAATTGCGAAATGTTCCTACTATTTTTCTTTTTCTCTTTTCGC
GAGTACTAATCACCGCGAACGGAAACTAATGAGTCCTCTGCGCGGAGACATGATTCCGCA
TGGGCGGCTCCTGTTAAGCCCCAGCGGAAATGTAATTCCACTGAGTGTCATTAAATAGTG
CCAAAGCTTTATCAAATTGTTTGCGATGAGATAAGATAAAAGGGACAATATGAGGAGGAA
CACAGGTATATAAATATCGCCAAATAAAAGGAAAATGTTTATACAGTTTTCTCTTTTTTA
AGTGCTGGATAGACAAGAGACAGGAAAATTAACCAGCGAG
Chr coordinates Chr III from 16880-15798
w3c xhtml validator w3c css validator