Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GEX1
Systematic Name YCL073C
Strain S288c
Description Proton:glutathione antiporter localized to the vacuolar and plasma membranes; imports glutathione from the vacuole and exports it through the plasma membrane; has a role in resistance to oxidative stress and modulation of the PKA pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GEX1 YCL073C
AATTTCTATCGATTAAGCTCTATACCAGGTATGATCTGGTCTGATCAGTTCTAGGTATAA
GCATAACTAGAATACATCTATACATGTGTATATCTATATCTATATATATGTATATATATA
TATTTAAACCAAAAAAAAAAAAAAATTCGCTTCTCATAAAGGTGTGATGACACTATTATC
TTTTGCATATCTTGTCGTCTCGTATCATGTACGCGCTGCATATGAGGTGCGGCGCTATCT
GTTAAATATGTACCAATTTGCACCTGCTGCAAAGGAAATGTGGCACTACTTTTACTCGCA
TGTTAACTTTCACCTACTATATATAGAAAAAAGGGTGTTGTTTTCAATCGCTGACTAATT
TGCTCAAATACTCTTTACAAAAAGGAAATTGTGTATCAGTAACCCTTACGGTTTGTTTAT
GAAGGAACTTTGCTCGTCCTACACCACCGGATCTAGGTACTCAATTTTTTGATGATTTTG
CACTTGTGCGCATATCCTGTCGACAGGCACCGCATTTTTTTCCTTGTTTCAACAGACATA
AACACAAGCTTCACTCATCAGTTTGAAAAGAGATAGTTTCGACGGTACAGTATTCTTGTC
GTACAAAAGTCTTCGGTATAACTGGTTCGTCGTGGATTTTCGGAAACTAAGTTGATTGTA
CGACGACAGGTCAAAGTTAAAGTTAAAGTCACCAGGTGTATAGACACCACATTGAAGGGG
TGTCACAGCAATTTTTTTTTTTTTTTTTTTTGATACTCAATAATTACGAGCATATAATTT
TAGTACTTCCAAAAAAAAAGTTAAACAAAAAATAGTGACGAAAGGTGTCAGTAAAAGTAT
ATATGAGAACATGGAATGTATTAAAGTAATTCCATTTCTAGCAGATGTAGCGACCGTAGA
ATCTTAAATACTATTTACATAAATAAGAAAAGTAAAATAGTTTTATGGACTGGAAAGAGA
AAAAAAAAAAAAAGGAATAATCAAGTAAATAAATTATCGG
Chr coordinates Chr III from 8326-6479
w3c xhtml validator w3c css validator