Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GEX1
Systematic Name YCL073C
Strain S288c
Description Proton:glutathione antiporter localized to the vacuolar and plasma membranes; imports glutathione from the vacuole and exports it through the plasma membrane; has a role in resistance to oxidative stress and modulation of the PKA pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>GEX1 YCL073C
ATGAGTTCTAGTGTTGTTGGTGCCTCAAGTAATAAAAAAAGTGGAATTAGGCAGTCCTGT
GAGATTATTGAGCGAGAACGTCACTCAAACGATGACACGTACTCTATGACATCGACCTTT
TTTAAGCTCAAAGAAAACGAAATTATGTCTGCACAGTTTGATTCCTTGAAATATAAAATT
CTACTGATAAGTACCGCGTTTGTATGTGGGTTTGGAATTAGTTTAGACTACACACTTAGA
TCGACCTATACGGGCTATGCGACGAACTCATATTCAGAACACTCCTTACTTTCAACTGTC
CAAGTTATCAATGCTGTTGTAAGTGTCGGATCCCAAGTTGTCTACTCCAGACTCTCTGAC
CACTTCGGAAGACTAAGGCTTTTTTTAGTTGCAACTATTTTTTATATAATGGGAACCATC
ATTCAATCACAGGCGACCCGTCTCACAATGTATGCAGCAGGATCGGTTTTCTATAACTGT
GGATACGTCGGAACAAATCTGCTCCTGACATTAATACTTTCTGATTTCTCCTCCTTGAAG
TGGAGAATGTTTTACCAGTACGCCTCATATTGGCCATATATCATAATACCATGGATTTCA
GGTAATATTATCACAGCAGCAAATCCTCAGAAAAACTGGTCCTGGAATATTGCAATGTGG
GCTTTTATTTACCCACTCTCTGCCTTGCCAATTATATTTCTTATTCTTTATATGAAGTAC
AAATCTTCAAAGACTGCTGAGTGGAGATCTCTCAAAGAACAGGCTAGAAAGGAAAGAACG
GGCGGATTATTTGAGAATTTGGTGTTTCTATTCTGGAAACTCGATATTGTTGGCATATTA
TTAATAACTGTGTCGCTAGGGTGTATCCTTGTCCCTTTGACGTTGGCTAATGAGACATCA
CAGAAGTGGCACAATTCAAAAATAATTGCCACTTTAGTTTCAGGTGGCTGTTTATTTTTC
ATTTTTTTATATTGGGAGGCCAAATTTGCCAAATCTCCTCTTCTACCGTTCAAATTACTA
AGTGATCGTGGAATTTGGGCACCCCTTGGTGTTACTTTTTTCAATTTTTTCACCTTTTTC
ATTTCGTGTGACTATCTGTATCCTGTTTTGCTGGTATCGATGAAAGAATCGTCCACTTCG
GCTGCTCGGATAGTAAACCTTCCTGACTTTGTTGCTGCTACTGCATCTCCATTCTACAGT
TTGTTGGTGGCAAAGACAAGGAAACTGAAACTTTCTGTAATCGGAGGTTGTGCTGCATGG
ATGGTGTGCATGGGCCTTTTTTACAAATACAGAGGAGGATCTGGGTCTCATGAAGGTGTT
ATCGCTGCATCTGTTATCATGGGTTTGAGTGGTCTCCTATGCAGCAATTCAGTGATCGTC
ATACTGCAAGCCATGACTACGCATAGTAGGATGGCTGTAATAACCGGCATCCAGTATACC
TTTTCAAAGCTAGGCGCTGCTATCGGTGCCTCCGTTTCTGGTGCCATATGGACACAAACC
ATGCCTAACCAACTCTACAAGAACCTTGGAAACGATACATTGGCAGAAATAGCATATGCA
TCACCTTATACATTCATTAGTGATTATCCTTGGGGCTCACCCGAAAGAGATGCTGTGGTT
GAATCTTACAGATATGTTCAACGAATAATAATGACGGTTGGCTTGGCATGTACGGTACCG
TTCTTTGCGTTTACAATGTTCATGAGAGACCCGGAACTAATAGACAAGGCGACACACGAA
GAATTCACTGAAGATGGTTTGGTTGTCTTGCCAGATGAGGAAAATATTTTCTCTCAAATC
AAGGCACTTTTTAGACATAATCGAAGTAACAAGAAATTAGGATGTTGA
Promoter Sequence
Download FASTA
>GEX1 YCL073C
AATTTCTATCGATTAAGCTCTATACCAGGTATGATCTGGTCTGATCAGTTCTAGGTATAA
GCATAACTAGAATACATCTATACATGTGTATATCTATATCTATATATATGTATATATATA
TATTTAAACCAAAAAAAAAAAAAAATTCGCTTCTCATAAAGGTGTGATGACACTATTATC
TTTTGCATATCTTGTCGTCTCGTATCATGTACGCGCTGCATATGAGGTGCGGCGCTATCT
GTTAAATATGTACCAATTTGCACCTGCTGCAAAGGAAATGTGGCACTACTTTTACTCGCA
TGTTAACTTTCACCTACTATATATAGAAAAAAGGGTGTTGTTTTCAATCGCTGACTAATT
TGCTCAAATACTCTTTACAAAAAGGAAATTGTGTATCAGTAACCCTTACGGTTTGTTTAT
GAAGGAACTTTGCTCGTCCTACACCACCGGATCTAGGTACTCAATTTTTTGATGATTTTG
CACTTGTGCGCATATCCTGTCGACAGGCACCGCATTTTTTTCCTTGTTTCAACAGACATA
AACACAAGCTTCACTCATCAGTTTGAAAAGAGATAGTTTCGACGGTACAGTATTCTTGTC
GTACAAAAGTCTTCGGTATAACTGGTTCGTCGTGGATTTTCGGAAACTAAGTTGATTGTA
CGACGACAGGTCAAAGTTAAAGTTAAAGTCACCAGGTGTATAGACACCACATTGAAGGGG
TGTCACAGCAATTTTTTTTTTTTTTTTTTTTGATACTCAATAATTACGAGCATATAATTT
TAGTACTTCCAAAAAAAAAGTTAAACAAAAAATAGTGACGAAAGGTGTCAGTAAAAGTAT
ATATGAGAACATGGAATGTATTAAAGTAATTCCATTTCTAGCAGATGTAGCGACCGTAGA
ATCTTAAATACTATTTACATAAATAAGAAAAGTAAAATAGTTTTATGGACTGGAAAGAGA
AAAAAAAAAAAAAGGAATAATCAAGTAAATAAATTATCGG
Chr coordinates Chr III from 8326-6479
w3c xhtml validator w3c css validator