Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCL074W
Systematic Name YCL074W
Strain S288c
Description Pseudogene: encodes fragment of Ty Pol protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCL074W YCL074W
TCCTCCAAGCCTGTAGATGAAATTGCTTCCTTTTTGAAAACTCTATTCACGATGCTTGAA
GACAATAGCGAAGAACAGGACAAAAAAAAAAGACGCGACACCAATATCGCGTTGTTATTA
ATGACCTTCTTACCCGAGTTAAAAGAATCATTCCACGAGAAATTCGGTGACTCTAAGGCT
CTTCAGCTATCACAAGTCATTAGATTCTGTAAATTAAATGCGTCATCGAATTCATCATCT
TCGGTCTCAGATGCATTGGTTGCACAAGACAGAAGAAACTATCAAAAGAAAGGAAATAAG
GGATGTATATAATTTACGGAGCTGATCATCGCATAAGCAACTGTTCTCTGCTTAAACGAA
GAATACCAGAAGCACGAATCTTTAAATTATATCCTAATGACAAAACGAGTAGATCTTCAT
CTGCTAGTGTCGCGATTCCTGACTATGAAACGCAAGGCCAAACAGCAGGACAGATAACAC
CGAAGTCCTGGCTCTGTATGTTATCTTCGACTGTTCCAGCTACCAAATCCTCAGAATGGA
TTTTTGACACAGGATGTACTTCCCACATGTGCCACGACCGTTCCATTTTTTCATCATTTA
CTAGATCCTCTAGGAAAGACTTTGTCAGAGGAGTTGGCGGTTCCATACCCATCATGGGCT
CCGGAACTGTAAACATTGGCACTGTTCAATTACATGACGTATCTTACGTTCCTGATTTAC
CAGTTAACCTGATATCCGTTTGAAAACTATGCACTAAATCAAACTCTTCTGTTACGTTCA
CAAAAGAGGGTGTCACTGTGCAATCACCTGATGATGTGGTTTCTACAGCTGGGTATTCAC
AATAAAAGACTCTGGGAAGTACAAAGCTCGCCTTGTCGCCCAAGGACATACTCAAAAGGC
TGGTATTGACTATCAGGAAACCTTTGCACCAGTCATTCGATATGACTCTGTTAGATTATT
TCTGGCCCTTGCTAGCTGCCTCAAACTAATAGTATATCAG
Chr coordinates
w3c xhtml validator w3c css validator