Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCR007C
Systematic Name YCR007C
Strain S288c
Description Putative integral membrane protein, member of DUP240 gene family; YCR007C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCR007C YCR007C
CTTGGCCATGGAGTCATTTTATCTTGTGTCACTTTTACAGAAAAAGTATTACTAATATAT
GTTGAAAATTTTCCAACTACCCTTCGAGTATGATTTTACAACTGCGTCAAAGAAACCATG
CAAAACAGTTGACTAATATCGCAACTGTTTTTTTTTCTCATTGCCTTTGAAAGAATGGAA
CACTCCTCACCACGAGGTTCTAAAAACTATACCAACCACAGTTTGGACGTACATCTGAAG
ATGGCATCCAATAGCAGCGGTATTCATTTGTGCGGGCTGGATTGAAAAAAGCATCACAAT
TATTGGGGCGTTTATTGTAGTCTTTGAACCGAGATAATCCAGGTGTTAAATATTGGTTGG
ATATGCATGCAAAATTTTCAGCAAAAACGATGGAAGCAGAACAAACAGTGCTTATCTTTG
CTTCTGCTCTTGTGTAAGTCTAAAGGACAATATCTTTGTTATTAAGCACTCTAGCTGCCC
ACTGTATAAACAGAACTTTTGACAAAAAGTCTAGCCAGCGATGATATAATTTGCCTGCAC
AAAGAGTTTACTATTAGTAGCACAACTAAGTCATCGAAACGCTTTTAGTGGACAGATCTA
AAGTTACAAATATTTAGGTATGCGTAAAAGGGTAATTAACCTAGTATCAAATGAGTCGAA
GCCCCGACCGCGCCCAGAAGAAAAGCCATTATCATTTAGGTGACGCCTTGTTCTAAGGCT
TAGTTAATAATATTCCTTTCAACCAAACAATGACCTTCCAAGGTGTTCAGTAAGTGGCTC
TCATTTTAAGTTAGTTGGGTATTATACGCCTTGTATCCGGGGCTATGCTTAGGTTAAATA
AGAATACTGCTTGAATAGCTCAAGTTTACAAAATAATTTAAAAAGAGTTTATGAACTTCA
ATAAAACTTCGAACCTGAAAATGTAAGTCTGTGTTCTGTTTATATACACCAGTCGGTTGT
CTATACCATATCAAGACAAGAAACAAAACTCCGTATCTGC
Chr coordinates Chr III from 126730-126011
w3c xhtml validator w3c css validator