Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADY2
Systematic Name YCR010C
Alias ATO1
Strain S288c
Description Acetate transporter required for normal sporulation; phosphorylated in mitochondria
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ADY2 YCR010C
ATGTCTGACAAGGAACAAACGAGCGGAAACACAGATTTGGAGAATGCACCAGCAGGATAC
TATAGTTCCCATGATAACGACGTTAATGGCGTTGCAGAAGATGAACGTCCATCTCATGAT
TCGTTGGGCAAGATTTACACTGGAGGTGATAACAATGAATATATCTATATTGGGCGTCAA
AAGTTTTTGAAGAGCGACTTATACCAAGCCTTTGGTGGTACCTTGAATCCAGGGTTAGCT
CCTGCTCCAGTGCACAAATTTGCTAATCCTGCGCCCTTAGGTCTTTCAGCCTTCGCGTTG
ACGACATTTGTGCTGTCCATGTTCAATGCGAGAGCGCAAGGGATCACTGTTCCTAATGTT
GTCGTCGGTTGTGCTATGTTTTATGGTGGTTTGGTGCAATTGATTGCTGGTATTTGGGAG
ATAGCTTTGGAAAATACTTTTGGTGGTACCGCATTATGTTCTTACGGTGGGTTTTGGTTG
AGTTTCGCTGCAATTTACATTCCTTGGTTTGGTATCTTGGAAGCTTACGAAGACAATGAA
TCTGATTTGAATAATGCTTTAGGATTTTATTTGTTGGGGTGGGCCATCTTTACGTTTGGT
TTAACCGTTTGTACCATGAAATCCACTGTTATGTTCTTTTTGTTGTTCTTCTTACTAGCA
TTAACTTTCCTACTGTTGTCTATTGGTCACTTTGCTAATAGACTTGGTGTCACAAGAGCT
GGTGGTGTCCTGGGAGTTGTTGTTGCTTTCATTGCTTGGTACAACGCATATGCAGGTGTT
GCTACAAAGCAGAATTCATATGTACTGGCTCGTCCATTCCCATTACCATCTACTGAAAGG
GTAATCTTTTAA
Promoter Sequence
Download FASTA
>ADY2 YCR010C
ACCTTGGGATATCGTTGGAAATCCTAACCATCGGCATAATTTTTGAAGACTTGAATAACT
CCATAATATTAAGCGTGCTGGTGCTTTTGGGCTCACTACTGTTTAGCGGACTATTTATCA
ATACTAAGAATATTACAAACGTGGCCTTCAAGTACCTGAAAAACTTCTCTGTGTTTTACT
ACGCCTACGAATCTTTATTGATCAATGAGGTCAAAACATTGATGCTGAAAGAGAGAAAGT
ACGGCTTAAATATTGAAGTTCCAGGCGCTACTATCTTGAGCACATTTGGATTTGTTGTCC
AAAACCTTGTATTTGACATCAAGATCCTGGCTCTGTTTAATGTGGTGTTTTTAATAATGG
GGTATCTAGCCCTTAAGTGGATAGTTGTGGAACAAAAGTAGATAGGCGTCGTATATAGTC
TCTTCTTTTACATAAGAAATAATAATTTTTGGCCCCGCAACTTTCCTTATTTTCGAGAGG
GTCCACTGCCCGTTGATCCGGAGCTCCGTGGAATAGGCGAGCGGCTGAGTGGTTCTCCAA
GCTACGGTTTTTACGTGTAGCCCCATGTGAGCAAGCCAAACAAGGGCCCTTAAAGGCGTG
ACTACAAAAAGGGGCGGGTTGGAAGGTCATCTGCAGCGAGATACGAAAAGATTTTTTGCC
AGATTTGCGGTTGGGCGGCTATTTCGGTATTGTTGGGGTAACAAACGTTGGGGAAGACTG
CATTTTCTTACAGCTTTTTTTCGTTATCGCGGGTTGGGCGGCTATGGCGCCTTCTCCTCT
GTACTCCAACCTGTCAGAGACACCAAGCTGTATATAAAGCACCTTGGTTGGATCGTATTT
CCCTGAGATCTTGCTATAGGTTCATTTTATATATCGTCCAATAGCAATAACAATACAACA
GAAACTACTAGCATCTGTTTATAAGAAAAAGGCAAATAGTCGACAGCTAACACAGATATA
ACTAAACAACCACAAAACAACTCATATACAAACAAATAAT
Chr coordinates Chr III from 133124-132273
w3c xhtml validator w3c css validator