Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PET18
Systematic Name YCR020C
Alias HIT2
Strain S288c
Description Protein of unknown function, has weak similarity to proteins involved in thiamin metabolism; expression is induced in the absence of thiamin
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>PET18 YCR020C
ATGAGCTGTACCACTGATAAGTTAATACAAAAGTACGACGCCCTTGTTAGGAAAACCACA
GAACATAAATTCGCTAAGGAACTATGTGCCGGAACATTGAAGGACCGTAGTTTGTACATC
TATTTATCACAAGATCTGCAATTTTTTGAAACTAGCTTAAGGTTGATATGTAAGACGACT
TCTTTAGCACCAACTACTCACGCTTTAATAACCTTAGCCAAAAAGATTGGATTTTTTTCT
AATGATGAAAACTCATACTTTCATGACTGCTTAGAATTATTGGCACCATCCCTCACCAAG
GAAGAAAGAGATAATTTTGACAATAAAGCGATCCCCGGCGTTGATGCGTATATTAATTTC
TTAGATGAGCTGAGAAAGGACGCCTCAATTACATGGCCATCCTTAGTAACCAGCTTATGG
GTTGCTGAGGAACTCTATTGGAGATGGGCTCGTGATACTCCTAGAGCCCCAGGGTTGCAT
TGGAAATATCAAAAATGGATTGATTTACATGATGGTGAGCATTTTCAAACTTGGTGTGAA
TTTCTAAAGGCTGAAGTTGACAAGTTTCCCGTCGAAGAAGTGGAAAGCATATTTGTGAAG
GTTTCACAGTTCGAGTTCGAATTTTTTGAATCTTGTTACAACGCCTAA
Promoter Sequence
Download FASTA
>PET18 YCR020C
GTGACTTTTGGTGAACTAGATACGCTTTGAAATTCTTCATTTGTAATGAAGCAGGATTCA
CATTCAATATTTTGTAGCTTACAATTGTGAATGTTGCGTTTTCCTACTTTTTCCTTTCAT
TTTTCAAAGCATCGAGCATTTTTTTCATTTCTTCCAAACTCATCCTTTGCCTTTCAGGAT
TGATAATACTATTGTGTCTTTCCGTACTTTCTACCAAGTTCAATAACTCGCATATGTTTT
CTCTTTGAGATAATAACTGAAATGCTGTTAAATTTTTCAGCGTTACATTGTTGTAAGCTC
TTTCAGGATTCATTGAGCTGATTGTGTTGTTCTGTGACATACGATATACTGATACTCTGT
TCTAAATAACACAATCCTTTCGTTCTATCATAAAATTCAATGTTATAGGCTCATTTTGTG
CATCTTATGTGGCGGATTAATTTTTTTTTTTTCAAAAAATATCTCGCGAAGTGCATGAGT
TCTGACTATTTTTTAAATGCGATGATATCATTGATAGGGTGAAGATAGTCTTCAACAAAC
TTAGTAAGGGGCACCAAAGCGTCATGGACATCTTGAAACTGTCAGATTTTATTGGAAATA
CTTTAATAGTTTCCCTTACAGAAGATCGTATTTTAGTTGGAAGCTTGGTTGCTGTAGATG
CCCAAATGAATTTGCTATTAGATCATGTTGAGGAACGTATGGGCTCCAGTAGTAGAATGA
TGGGCCTAGTCAGCGTCCCTAGGCGTTCCGTTAAGACCATAATGATTGATAAGCCTGTTC
TGCAGGAGCTTACTGCGAATAAAGTTGAATTGATGGCTAATATTGTTTAGCGCATATGGT
TCTAATAGTTTCCATAGTAACAATTGCTTGGCAAAAAAGGTCTGGCTTCGAAAGATATAT
AAACGAATATGAACTGGACTGAACTTAGATATTTTTTTCTGTATTAACTAAAATTTAGCG
CAAATAATAACAATATCAACAATATCTGCAAGGAAGAACA
Chr coordinates Chr III from 154659-154012
w3c xhtml validator w3c css validator