Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP30
Systematic Name YCR021C
Alias YRO1
Strain S288c
Description Hydrophobic plasma membrane localized, stress-responsive protein that negatively regulates the H(+)-ATPase Pma1p; induced by heat shock, ethanol treatment, weak organic acid, glucose limitation, and entry into stationary phase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP30 YCR021C
AAAGTAGAAAACTTGAGCACTTATTTCCTGCGCATGTCATATGTTAATTTTCCTCAACTG
CGCTGAATACGTCCTGTCAATTCAAATATATCACGTTGTGAGCAGCCCTGAAGAAGAAAA
CCTCAACAGCAGTATTACTATTACAATCAAACAACTTTAGTGCCGCGTGATACCGGGGGT
TGAAGTGGGTGCATTGAGCCGTATTCTTCTTCCCCGTAAGAAAGTTGTGTATCCTTTTTA
CTGCGTTGTAATAGCTTCTGAAAACCTAAAAAATGAACGCTATGTAGCTCATATCCGTTT
TGCATAAGTAAGAATAACTACTTGTGCAGGGTGCCGAAAGGGATGGAAAACCGCTGCAGC
AACCCTTGTTACATACAGTCGGATCCATCTGACTTACTTTCCTTGCGTCTCCCTGCGCGA
TTTTGTTGGCCATTTTCCAGATCCTCTAGAATTTTTCAAGGGTCGAGCCGTAGGAGGATT
CTCTCAGAAGGCAAAAACGCATCGAAAGCGTGCTTTGTAAGAATATTTGGTATGGCTAAA
GTAAGCAAAGCCATATCCCGATCCCGATCCCGACTCTTATTCCGATCCCTTCCGCCACAT
CCTGCATGTTTATTCGAATACCAAATTAGCTCATCTTCGTTATTTCATCATCCCTTTCTG
CTATGGCAAGGACAAGTTTTTTTCTAGCATCTCATCGAAAACTTTCCTCTCCCTAATTGG
CCAAAGTTTTCATATTCATCATCAGTTAGAAAGTATAATATCAATCCCTTACCTCATTAC
AAGTTGTATCACACTAAAAAAATCATATATAAGTCTGTGAGAGTCTTCAATTATTTAGCG
TAACACCTATTCACTTTCTAATCTTGTTTCTTGTTTTTACATTCTGCAATACAACACAAC
AACAAATATTAACTCAATTATTATTATTTATAATTACAAAAACAAAACAACAAGTTTGAG
ACTTTAATATCTTTTGATTACTAAAAACAACAAATTTCAA
Chr coordinates Chr III from 157107-156109
w3c xhtml validator w3c css validator