Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP30
Systematic Name YCR021C
Alias YRO1
Strain S288c
Description Hydrophobic plasma membrane localized, stress-responsive protein that negatively regulates the H(+)-ATPase Pma1p; induced by heat shock, ethanol treatment, weak organic acid, glucose limitation, and entry into stationary phase
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>HSP30 YCR021C
ATGAACGATACGCTATCAAGCTTTTTAAATCGTAACGAGGCTTTAGGGCTTAATCCACCA
CATGGCCTGGATATGCACATTACCAAGAGAGGTTCGGATTGGTTATGGGCAGTGTTTGCA
GTCTTTGGCTTTATATTGCTATGCTATGTTGTGATGTTCTTCATTGCGGAGAACAAGGGC
TCCAGATTGACTAGATATGCCTTAGCTCCTGCATTTTTGATCACTTTCTTTGAATTTTTT
GCTTTCTTCACTTATGCTTCTGATTTAGGTTGGACTGGTGTTCAAGCTGAATTTAACCAC
GTCAAGGTTAGCAAGTCTATCACAGGTGAAGTTCCCGGTATTAGACAAATCTTTTACTCG
AAATATATTGCCTGGTTCTTGTCCTGGCCATGCCTTTTATTTTTAATCGAGTTAGCCGCT
AGTACTACTGGTGAGAATGACGACATTTCCGCCTTGGATATGGTACATTCGCTGTTAATT
CAAATCGTGGGTACCTTATTCTGGGTTGTTTCGCTATTAGTTGGTTCATTGATCAAGTCC
ACCTACAAGTGGGGTTATTACACCATTGGTGCTGTCGCTATGTTGGTTACCCAAGGTGTG
ATATGCCAACGTCAATTCTTCAATTTGAAAACTAGAGGGTTCAATGCACTTATGCTGTGT
ACCTGCATGGTAATCGTTTGGTTGTACTTTATCTGTTGGGGTCTAAGTGATGGTGGTAAC
CGTATTCAACCAGACGGTGAGGCTATCTTTTATGGTGTTTTGGATTTATGTGTATTTGCC
ATTTATCCATGTTACTTGCTAATTGCAGTCAGCCGTGATGGCAAATTGCCAAGGCTATCT
TTGACAGGAGGATTCTCTCATCACCATGCTACGGACGATGTGGAAGATGCGGCTCCTGAA
ACAAAAGAAGCTGTTCCAGAGAGCCCAAGAGCATCTGGAGAGACTGCAATCCACGAACCC
GAACCTGAAGCAGAGCAAGCTGTCGAAGATACTGCTTAG
Promoter Sequence
Download FASTA
>HSP30 YCR021C
AAAGTAGAAAACTTGAGCACTTATTTCCTGCGCATGTCATATGTTAATTTTCCTCAACTG
CGCTGAATACGTCCTGTCAATTCAAATATATCACGTTGTGAGCAGCCCTGAAGAAGAAAA
CCTCAACAGCAGTATTACTATTACAATCAAACAACTTTAGTGCCGCGTGATACCGGGGGT
TGAAGTGGGTGCATTGAGCCGTATTCTTCTTCCCCGTAAGAAAGTTGTGTATCCTTTTTA
CTGCGTTGTAATAGCTTCTGAAAACCTAAAAAATGAACGCTATGTAGCTCATATCCGTTT
TGCATAAGTAAGAATAACTACTTGTGCAGGGTGCCGAAAGGGATGGAAAACCGCTGCAGC
AACCCTTGTTACATACAGTCGGATCCATCTGACTTACTTTCCTTGCGTCTCCCTGCGCGA
TTTTGTTGGCCATTTTCCAGATCCTCTAGAATTTTTCAAGGGTCGAGCCGTAGGAGGATT
CTCTCAGAAGGCAAAAACGCATCGAAAGCGTGCTTTGTAAGAATATTTGGTATGGCTAAA
GTAAGCAAAGCCATATCCCGATCCCGATCCCGACTCTTATTCCGATCCCTTCCGCCACAT
CCTGCATGTTTATTCGAATACCAAATTAGCTCATCTTCGTTATTTCATCATCCCTTTCTG
CTATGGCAAGGACAAGTTTTTTTCTAGCATCTCATCGAAAACTTTCCTCTCCCTAATTGG
CCAAAGTTTTCATATTCATCATCAGTTAGAAAGTATAATATCAATCCCTTACCTCATTAC
AAGTTGTATCACACTAAAAAAATCATATATAAGTCTGTGAGAGTCTTCAATTATTTAGCG
TAACACCTATTCACTTTCTAATCTTGTTTCTTGTTTTTACATTCTGCAATACAACACAAC
AACAAATATTAACTCAATTATTATTATTTATAATTACAAAAACAAAACAACAAGTTTGAG
ACTTTAATATCTTTTGATTACTAAAAACAACAAATTTCAA
Chr coordinates Chr III from 157107-156109
w3c xhtml validator w3c css validator