Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PMP1
Systematic Name YCR024C-A
Strain S288c
Description Small single-membrane span proteolipid that functions as a regulatory subunit of the plasma membrane H(+)-ATPase Pma1p, forms unique helix and positively charged cytoplasmic domain that is able to specifically segregate phosphatidylserines
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PMP1 YCR024C-A
TTGTGAGTCCCGCGCAAGAAAACATATGCACGCAGAAAGAGACTTTTATTTAGATTTAGT
ATATCTCTAAACTTAATTCAGAAGTGAACCACTCTCTCACATCCGATGACAGTGGGGTCA
ATAAGATGTACTAAGTAAGAAAACTAATTACACAATAAAAAGAAACAAGCTGAAACTAGG
CGTGTTAACTCTTTCCTAAACGAGGAGGTTTATGTCGTCATTTGGACATCGAGCATTTTT
CAGCTGTTGTCCTTTACTAGAAGGAGAAACTTTGCATTCAATAAAATTGCGCAAAGAGGC
AACATACCAAACTCAATCCGGGTGGCCGGTTCGATGGCCGATTCGGTATCCGCGCGCACT
TCCCCTAGAATCCCACGTGCACCCATACCATATGATCGTTAAATTACCGCACCCACGCAC
CCAACCGCGGCTGTTTCTATGGCTGTCGTTGCATTGGACAGGAATTCCTTTTTTGGGAAA
GCCGGGAATAGGTCGCAATCGGGTAAAATCAAAACAATTTTCGCATTTCCAACAGAGTAA
AATCAAAACAACTATGAGAAAAAAAACAACAAACAGAAAGCAGAAAGCAGAAAGATGTCA
ATATAGACTTGTCACTGCGTAATAGAAGATAGCTTCAATTTTTTCCGATAATAATTTCCC
ATTTTTTTTTTTCAAATTTAGCCTTCCGTGCTTGCCAGTATATAAAGCTTTGAAAGCAAT
TTATTGTTTCTCTTGTAATCTTAACTTCCCTTTTTTTCTCTTATTGCGTCTTATCTTCCT
TTAGAGTTTTTCATTACTACCCTTTTTCCATTTATTCTTTTTCCCTTTCAATAGTATTTA
AAGGAAGACGCTACACACTTTGAAGGAAGAGCAAATAAGTTAACTTTTTCATCTCTTTTT
TTTTCTCAACTTCAAACTAGTCACTCAAGCAAACTTTTGTTCCTACATATCCTTTGTTTG
TTTCTCCTCTTCCCATTTCAGCACTTTTAATCTATCATAA
Chr coordinates Chr III from 163067-162945
w3c xhtml validator w3c css validator