Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ELO2
Systematic Name YCR034W
Alias ELO2, FEN1, GNS1, VBM2
Strain S288c
Description Fatty acid elongase, involved in sphingolipid biosynthesis; acts on fatty acids of up to 24 carbons in length; mutations have regulatory effects on 1,3-beta-glucan synthase, vacuolar ATPase, and the secretory pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ELO2 YCR034W
ATGAATTCACTCGTTACTCAATATGCTGCTCCGTTGTTCGAGCGTTATCCCCAACTTCAT
GACTATTTACCAACTTTGGAGCGACCATTTTTTAATATTTCGTTGTGGGAACATTTCGAT
GATGTCGTCACTCGTGTAACTAACGGTAGATTTGTTCCAAGCGAATTCCAATTCATTGCA
GGTGAATTACCATTAAGCACTTTGCCCCCTGTGCTATACGCCATCACTGCCTATTACGTT
ATTATTTTTGGTGGCAGGTTTTTGTTAAGTAAGTCGAAACCATTTAAATTAAATGGCCTT
TTCCAATTGCATAATTTGGTTTTAACTTCACTTTCATTGACGCTTTTATTGCTTATGGTT
GAACAATTAGTGCCAATTATTGTTCAGCACGGGTTATACTTCGCTATCTGTAATATTGGT
GCTTGGACTCAACCGCTCGTTACATTATATTACATGAATTACATTGTCAAGTTTATTGAA
TTTATAGACACCTTTTTCTTGGTGCTAAAACATAAAAAATTGACATTTTTGCATACTTAT
CACCATGGCGCTACTGCCTTATTATGTTACACCCAATTGATGGGCACCACATCTATTTCT
TGGGTCCCTATTTCATTGAACCTTGGTGTTCACGTGGTTATGTATTGGTACTATTTCTTG
GCTGCCAGAGGCATCAGGGTCTGGTGGAAGGAATGGGTTACCAGATTTCAAATTATCCAA
TTTGTTTTGGATATCGGTTTCATATATTTTGCTGTCTACCAAAAAGCAGTTCACTTGTAT
TTCCCAATTTTGCCACATTGTGGTGACTGTGTGGGTTCAACAACTGCCACCTTTGCAGGT
TGTGCCATTATTTCTTCATATTTGGTACTATTTATTTCATTTTACATTAACGTTTATAAA
CGTAAAGGCACCAAAACCAGTAGAGTGGTAAAGCGTGCCCACGGCGGTGTTGCCGCAAAG
GTTAATGAGTATGTTAACGTTGACTTGAAAAACGTTCCTACTCCATCTCCATCACCAAAA
CCTCAACACAGAAGAAAAAGGTAA
Promoter Sequence
Download FASTA
>ELO2 YCR034W
TACCATCTATTCAGTTTCCTCGTTCAGAAATGGCAGAACCTACAGTGACAGATTTGCGTA
ACAGGCCCTTAGACCATATTGACACGTTGGCTGATGCAGCTTCGTCAGTAACAAATAATC
AAAACTTCAGTAATGAAAGGAATGCAATTGACATTGGCCGTAAATCGACGACAATCAGCA
ATCTATTGAATAATTCGGATCGAAGCATGAAATCTTCTTTCCAAAGCGCTTCAAGACACG
AAGCACAGCTCGAAGACACTCCCAGCATGAACAATATTGTAGTACAAGAAATAAAACCGA
ATATTACTACGCCAAGATCGAGTTCTATTTCTGCATTACTAAATCCTGTAAATGGGAATG
GGCAATCAAACCCAGATGGAAGGCCGTTGCTGCCATTTCAGCATGCTATTTCTCAAGGCA
CTCCTACTTTCCCTTTACCGGCCCCTCGCACTAGTCCAATAAGTCGTGCGCCTCCAAAGT
TCAATTTTTCGAATGATCCGTTGGCAGCTTTGGCTGCGGTTGCCTCCGCGCCAGATGCAA
TGAGCAGTTTTTTATCTAAAAAGGAAAATAATAATTGAACAAACGGCTGAGACGGGCAAT
ACATATGCTCTACTTCTTTTCCATCCAATGGTTGGTGAAACTCTCGAGCATACATTACCT
TACGTGTGTTAGTGTACTATATTATATATATATATATGTATATATATAAAGGGAGGAGTT
TTTAATTATAATTGTAATTTCGTATTTTTTCTGCATTATACAGTTTTTTCCGATTTTAAA
CGACTTTATTTAAGTGTCGTGTAAATATGTCACATTTTATTTTTGTACGTATTCACATGT
CCTGGCGTGCGGCCATTGCTGAAAATCGCAAAACCCACAGAGAAATAAACATCGCGAAAA
AGTCAATGAAAAATTGGAAAATATTTTTCATTTCACTATTATCCACAAGCAATTTTGTAC
AAAGTGAAAAGGTTGAACTAATTATCTTCGTCTAGAAGCC
Chr coordinates Chr III from 190592-191635
w3c xhtml validator w3c css validator