Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RBK1
Systematic Name YCR036W
Strain S288c
Description Putative ribokinase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RBK1 YCR036W
ACGCTCTGTAAAGCGTACATCAAAGAATTCCAACACAAATCGAAGACTGGACCAGTGCGA
CTCAAGACTACAATTTTCGCATACAAAACGTATGACCATTTTCTTTTCATTTTCAGGTTT
GTTTCATTCAGCGTATCATCTTCTAATTCATCGGGATACAAGACGGAAAACGTACCGTCT
TCATTCGCACTACGAACACCAGCTTTTACCTTCAAGGCTTTTTTAGGCAATATCCTAGAG
TGCAATATGGAATCGTGTAGTTTTTGTGATATAGTCATTTCTTCATCGGTGCAAGCGCCC
ACTCTACCTCTTTCAACTTCCACCACCGGATAGACAGAAGCATAATTTGCAATTATGTCC
TCCTCTTTGGTCACTTCGAACAATTCTTCCTCACCGAAATCATCCAAATCTTTAATCGCG
GCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTATGACTATGGTTTTCCCACTT
TTCAAAACATTTGAGCCTAAAATGTTGTTTTTAGTGTCTATATTACCAGCATCCGCATAA
CGCGATAAAGTATTATTTTCTATAGCAACATCTCTAAATTCTTCATATTTTCTTAGACAT
GGCCTGATTCCTAGGGATAAGTGTCTTTGTAAAGACAATTCTGGAGATATTCTCGCAAGA
ACTTCAGGTGGAAAAGTAATTGGGTGTATCTCAATAGTTTCTAACGTGGTACTTTCAGCC
ATTTCCAATATTAGATGCCTGTGAAACTACTGTCAAACTTATTTGTGTAACAATACTCAT
CGTCTAATTTGTCCATTATTGTTATATACTCTGTCATAAAAAAAGAAAGAAAAATCTTAT
ACTTTCGTCGACTGTGATTTGAAAATCTCTCCAGATCAAACGGGAATAAAAGGGTTTATA
TCCGAAGGTGGCCAGAACAATCATGAAGCAAATAGGATAAAAATAGCCAATAAGATGTTT
GTTGTCTTTCATCCCAAAGTTCCAACAGCATATTTCAAAG
Chr coordinates Chr III from 193297-194298
w3c xhtml validator w3c css validator