Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RBK1
Systematic Name YCR036W
Strain S288c
Description Putative ribokinase
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>RBK1 YCR036W
ATGGGTATTACAGTAATAGGTTCTCTAAACTATGATTTGGACACATTTACGGATAGATTA
CCTAACGCTGGAGAAACTTTCAGGGCTAACCACTTCGAAACACATGCTGGTGGTAAGGGA
TTGAACCAAGCTGCGGCCATTGGTAAATTAAAAAACCCCAGCAGCAGATATAGTGTTCGA
ATGATTGGTAATGTTGGAAATGATACATTTGGTAAACAATTGAAGGACACTTTATCCGAT
TGCGGAGTCGATATCACTCACGTCGGTACTTACGAAGGCATTAATACGGGTACCGCTACC
ATACTAATTGAAGAGAAAGCTGGTGGCCAAAATAGGATATTGATTGTAGAAGGTGCTAAC
AGCAAGACTATTTATGACCCGAAACAGTTGTGTGAAATTTTTCCAGAGGGCAAGGAGGAA
GAAGAGTATGTTGTTTTTCAACACGAAATTCCTGATCCTCTTTCCATTATTAAATGGATA
CATGCGAACAGGCCGAATTTTCAGATCGTATATAACCCCTCACCTTTCAAGGCCATGCCT
AAGAAAGATTGGGAGTTGGTAGACCTTTTGGTCGTTAATGAAATTGAGGGTCTTCAAATC
GTGGAAAGTGTATTTGATAATGAACTTGTTGAAGAAATAAGGGAGAAGATAAAGGACGAC
TTTTTAGGAGAATATCGTAAAATTTGTGAGCTTTTGTATGAAAAACTCATGAATCGAAAG
AAAAGAGGAATTGTGGTTATGACTTTGGGTTCGAGAGGGGTGCTTTTCTGTTCGCACGAA
AGCCCTGAAGTACAATTCCTTCCGGCTATTCAAAATGTTTCGGTTGTTGATACTACAGGA
GCTGGAGATACTTTCCTGGGCGGTTTGGTTACTCAATTGTATCAAGGAGAGACCTTGTCT
ACGGCTATAAAGTTCTCTACATTAGCTAGTTCATTGACCATTCAAAGAAAAGGTGCTGCT
GAAAGCATGCCACTGTATAAAGATGTTCAGAAAGATGCATAA
Promoter Sequence
Download FASTA
>RBK1 YCR036W
ACGCTCTGTAAAGCGTACATCAAAGAATTCCAACACAAATCGAAGACTGGACCAGTGCGA
CTCAAGACTACAATTTTCGCATACAAAACGTATGACCATTTTCTTTTCATTTTCAGGTTT
GTTTCATTCAGCGTATCATCTTCTAATTCATCGGGATACAAGACGGAAAACGTACCGTCT
TCATTCGCACTACGAACACCAGCTTTTACCTTCAAGGCTTTTTTAGGCAATATCCTAGAG
TGCAATATGGAATCGTGTAGTTTTTGTGATATAGTCATTTCTTCATCGGTGCAAGCGCCC
ACTCTACCTCTTTCAACTTCCACCACCGGATAGACAGAAGCATAATTTGCAATTATGTCC
TCCTCTTTGGTCACTTCGAACAATTCTTCCTCACCGAAATCATCCAAATCTTTAATCGCG
GCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTATGACTATGGTTTTCCCACTT
TTCAAAACATTTGAGCCTAAAATGTTGTTTTTAGTGTCTATATTACCAGCATCCGCATAA
CGCGATAAAGTATTATTTTCTATAGCAACATCTCTAAATTCTTCATATTTTCTTAGACAT
GGCCTGATTCCTAGGGATAAGTGTCTTTGTAAAGACAATTCTGGAGATATTCTCGCAAGA
ACTTCAGGTGGAAAAGTAATTGGGTGTATCTCAATAGTTTCTAACGTGGTACTTTCAGCC
ATTTCCAATATTAGATGCCTGTGAAACTACTGTCAAACTTATTTGTGTAACAATACTCAT
CGTCTAATTTGTCCATTATTGTTATATACTCTGTCATAAAAAAAGAAAGAAAAATCTTAT
ACTTTCGTCGACTGTGATTTGAAAATCTCTCCAGATCAAACGGGAATAAAAGGGTTTATA
TCCGAAGGTGGCCAGAACAATCATGAAGCAAATAGGATAAAAATAGCCAATAAGATGTTT
GTTGTCTTTCATCCCAAAGTTCCAACAGCATATTTCAAAG
Chr coordinates Chr III from 193297-194298
w3c xhtml validator w3c css validator