Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO87
Systematic Name YCR037C
Strain S288c
Description Low-affinity inorganic phosphate (Pi) transporter, involved in activation of PHO pathway; expression is independent of Pi concentration and Pho4p activity; contains 12 membrane-spanning segments
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO87 YCR037C
CCAGTTATCGTCCTACGTTCTTGAGACAACTTTGCAGCAAACGCACACCATTTCCTACTG
GTTACAAGTTGCACTGTCTTGTCTATACTTACGAAACTTAAACTCACTTGCTTCAATCAT
TACATCATTGCAAAATCATTCAATAGAAAGACTATCTCTCCCGATAGATGTTAAATCAGA
CCACCTTTTTCAGCGCCTAAAAGTCGTCGTACATCCAAACAACAACTACAACGTTTATAG
AAGAACAATTAAACATATTTTCCACAGTCAGCTTCCTTGTGTACCTTTTACATCACTGCT
TATCAGGGACATTACCTTCATAAGAGACGGAAACGATACATTCACTAAAGATGGTAATAA
CGTGAATATGCAAAAGTTCAACCAAATCACAAAGATAGTCGCTTTTGCGCAATATTTACA
ACAAAAGCAATATGAAGATATACACTGTTCAAATACTACTGCAAGAAGCTTATTAGGGGC
TATGATAAAGGTGCACACTTTATATAACGACAACAAAGACAGGGCGTATCAAGTCAGTAT
AGCTAAGGTTCCAAGGCTTACCTAAAAACAGAACTGTTCAAAGAAAGATGACTTCCTTTT
GCTTCTTGTACGCTCACAAATAATTAATATTCATGTTTAGTACTGAAAATTAAGAATACT
TGCATAACTACAGTAGATAATATTTTTTGATAAGAAACCAGACGTAAATTAGATGTAATC
TTTTACAGATATTACAGTCAACTTAATCAATTACCTAAAAAGGTTTAAGATTGTGCATAG
GAAACGTTTCAATTACCGTATCTTTAGGCTACCGCCTCTTTCTTATTTTCCCTTACCCTT
TTTTCAATCTAATTAATTGATGATTTCGCACGTGGGAAAAGTAATCCGATGCATTGAAAA
ATTATTACCAGAAAACAGTGTTTCACACCAAAAAAGCAGTCAGCTCTCAGATAAAGGTGC
AGCAAAACTACGGTAAAGGCGGCTATTATTGTGCCTCGAA
Chr coordinates Chr III from 197185-194414
w3c xhtml validator w3c css validator