Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MATALPHA2
Systematic Name YCR039C
Alias ALPHA2
Strain S288c
Description Homeobox-domain protein that, with Mcm1p, represses a-specific genes in haploids; acts with A1p to repress transcription of haploid-specific genes in diploids; one of two genes encoded by the MATalpha mating type cassette
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MATALPHA2 YCR039C
ATTGATTGTTTGCTTGAGTCTGAGTAATATCATATTTTATACAAATACATAGACATAAAC
AAAAGAGGCAAGTAGATAAGGGTATAGCCATATGAGTGTATAAACAAACATTGGGAACAA
GAGCAAGACGATGGGGAGTTTCAAATAGGATAGCTATACTGACAACATTCAGTACTCGAA
AGATAAACAACCTCCGCCACGACCACACTCTATAAGGCCAAATGTACAAACACATCTTCC
CAATATCCGTCACCACGTACTTCAGCATAATTATTCGTCAACCACTCTACAAAACCAAAA
CCAGGGTTTATAAAATTATACTGTTGCGCGAAGTAGTCCCATATTCCGTGCTGCATTTTG
TCCGCGTGCCATTCTTCAGCGAGCAGAGAAGACAAGACATTTTGTTTTACACCGGAGCCA
AACTGTGAGTAATATGCTCTAAAAGCCATAAATGAGTTTAAATATTTCTTTGAAGATTTT
ATAGATGTCTTATTGAACTGTCGAAACTGAGTATTTTGACTTCCAGACGCTATCCTGTGA
ATTTGGATTTTATTTAAAAATCGAGAGGAAGGAACAGGAATCTGGATATCTTTCTTGAGT
GGTCGAATAATATTGAAGCAGCTTGGCCTCACATGCTCAGCTAGACGTTTTTCTTTCAGC
TTTTTTGAAACCGCTGTGTTTCTGTATGATTTGGATGCTTTGTTCTTAATTTTGAAAGCA
GGCTTCGAAGTAAACATATTGTGAATGTCGTCTATTAAGTTATTATATATGGTTGATACA
TTTCATAAAAAGTGAAGGTTAAAAGAAGTAGTTAAGAGTTTAAGTTGTTTCATATGATGT
ACTTTTCTACATTGGGAAGCAATAAATTGCATCCCAAACAAAACCCAGACATCATTAATG
TTTTGAAACATAAAATGTTGGAACTTAAAAATATATATAAAGGAGAGATTGAAATCAGCT
TAGAAGTGGGCAAGAAAAAAAGGAAGATAAGCAAGAAAAA
Chr coordinates Chr III from 200178-199546
w3c xhtml validator w3c css validator