Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MATALPHA1
Systematic Name YCR040W
Alias ALPHA1
Strain S288c
Description Transcriptional co-activator involved in regulation of mating-type-specific gene expression; targets the transcription factor Mcm1p to the promoters of alpha-specific genes; one of two genes encoded by the MATalpha mating type cassette
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MATALPHA1 YCR040W
AAACATCTTAGTAGTGTCTGAGGAGAGGGTTGATTGTTTATGTATTTTTGCGAAATATAT
ATATATATATTCTACACAGATATATACATATTTGTTTTTCGGGCTCATTCTTTCTTCTTT
GCCAGAGGCTCACCGCTCAAGAGGTCCGCTAATTCTGGAGCGATTGTTATTGTTTTTTCT
TTTCTTCTTCTATTCGAAACCCAGTTTTTGATTTGAATGCGAGATAAACTGGTATTCTTC
ATTAGATTCTCTAGGCCCTTGGTATCTAGATATGGGTTCTCGATGTTCTTTGCAAACCAA
CTTTCTAGTATTCGGACATTTTCTTTTGTAAACCGGTGTCCTCTGTAAGGTTTAGTACTT
TTGTTTATCATATCTTGAGTTACCACATTAAATACCAACCCATCCGCCGATTTATTTTTC
TGTGTAAGTTGATAATTACTTCTATCGTTTTCTATGCTGCGCATTTCTTTGAGTAATACA
GTAATGGTAGTAGTGAGTTGAGATGTTGTTTGCAACAACTTCTTCTCCTCATCACTAATC
TTACGGTTTTTGTTGGCCCTAGATAAGAATCCTAATATATCCCTTAATTCAACTTCTTCT
TCTGTTGTTACACTCTCTGGTAACTTAGGTAAATTACAGCAAATAGAAAAGAGCTTTTTA
TTTATGTCTAGTATGCTGGATTTAAACTCATCTGTGATTTGTGGATTTAAAAGGTCTTTA
ATGGGTATTTTATTCATTTTTTCTTGCTTATCTTCCTTTTTTTCTTGCCCACTTCTAAGC
TGATTTCAATCTCTCCTTTATATATATTTTTAAGTTCCAACATTTTATGTTTCAAAACAT
TAATGATGTCTGGGTTTTGTTTGGGATGCAATTTATTGCTTCCCAATGTAGAAAAGTACA
TCATATGAAACAACTTAAACTCTTAACTACTTCTTTTAACCTTCACTTTTTATGAAATGT
ATCAACCATATATAATAACTTAATAGACGACATTCACAAT
Chr coordinates Chr III from 200442-200969
w3c xhtml validator w3c css validator