Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCR041W
Systematic Name YCR041W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCR041W YCR041W
TGAGTAATACAGTAATGGTAGTAGTGAGTTGAGATGTTGTTTGCAACAACTTCTTCTCCT
CATCACTAATCTTACGGTTTTTGTTGGCCCTAGATAAGAATCCTAATATATCCCTTAATT
CAACTTCTTCTTCTGTTGTTACACTCTCTGGTAACTTAGGTAAATTACAGCAAATAGAAA
AGAGCTTTTTATTTATGTCTAGTATGCTGGATTTAAACTCATCTGTGATTTGTGGATTTA
AAAGGTCTTTAATGGGTATTTTATTCATTTTTTCTTGCTTATCTTCCTTTTTTTCTTGCC
CACTTCTAAGCTGATTTCAATCTCTCCTTTATATATATTTTTAAGTTCCAACATTTTATG
TTTCAAAACATTAATGATGTCTGGGTTTTGTTTGGGATGCAATTTATTGCTTCCCAATGT
AGAAAAGTACATCATATGAAACAACTTAAACTCTTAACTACTTCTTTTAACCTTCACTTT
TTATGAAATGTATCAACCATATATAATAACTTAATAGACGACATTCACAATATGTTTACT
TCGAAGCCTGCTTTCAAAATTAAGAACAAAGCATCCAAATCATACAGAAACACAGCGGTT
TCAAAAAAGCTGAAAGAAAAACGTCTAGCTGAGCATGTGAGGCCAAGCTGCTTCAATATT
ATTCGACCACTCAAGAAAGATATCCAGATTCCTGTTCCTTCCTCTCGATTTTTAAATAAA
ATCCAAATTCACAGGATAGCGTCTGGAAGTCAAAATACTCAGTTTCGACAGTTCAATAAG
ACATCTATAAAATCTTCAAAGAAATATTTAAACTCATTTATGGCTTTTAGAGCATATTAC
TCACAGTTTGGCTCCGGTGTAAAACAAAATGTCTTGTCTTCTCTGCTCGCTGAAGAATGG
CACGCGGACAAAATGCAGCACGGAATATGGGACTACTTCGCGCAACAGTATAATTTTATA
AACCCTGGTTTTGGTTTTGTAGAGTGGTTGACGAATAATT
Chr coordinates Chr III from 200911-201243
w3c xhtml validator w3c css validator