Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BUD23
Systematic Name YCR047C
Strain S288c
Description Methyltransferase, methylates residue G1575 of 18S rRNA; required for rRNA processing and nuclear export of 40S ribosomal subunits independently of methylation activity; diploid mutant displays random budding pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BUD23 YCR047C
GTGCAGCACCTGATGGCTATCCAGCCCAAGAACATCCATGCGAACACGTAGATCCCTGAA
AAGTTCGACTCCAGTTTTTCTCCTGGGGGGGCATCTGCCTTGTCCGTTTTCTCCGTAGTC
TTCACCGTAGTCTTCACCGTGGCCTTGGTCTTGGTCTTTGTCAACTGTAAATTTTTGAGC
TGTTTCTCCAGCACCGGACCTTTGAAAGTCGTCTGGAAGGGCACGTTGATGGCGCTGTCC
AGGAGCGTGGGGCGAGGATCAAAACTCACGTCCCCAAAAAACGACACATACTTGCTAGCA
TCCTTTCGGTGGAACCTCGACCGAGACTTGCTCTTCAGGTGTGAAAGGTACTTTTGCATG
TGGGCGTCCACAGGGTACTCCTCCTCCTGCTCCTGCTTCCCTGCCACACGTTCCGCCTCA
GTCGACTCCACTCCTTCAGTCGACTCCACTGGCTCCACCAGCGACGTGGTAGACGACCGT
GGCGAAACCTCCATGGACTCCTGTGGCAGGATCACGTTATCGTACGTGACCGAATGCCGT
TTGTTGGCTTCTGCGGAATTGAGTCTGCGGATCTTAAGAAACTCTTCGTCTTGCAACAAA
TCCTTAGTCTCCGTCATTCTTGCAATCTGTTTTGGCGCTCTTGCTGCAAGCCGTGCTGAA
CAACCACCTGCGTGAGTGTGCCAATGGCGCCCCTTTCCTCCACCACGCTCGTCCTTCTTA
TATCATCCGCATGTTGCCAGGGTCTGCTGGGTGCTATTGTTCGCTAAACGAGTCCAACCA
CGGCCGGGTATTTGATGGCCAAGCCAGATTTTTTTTTTTTTTTCACTCTACACCATCTCA
CATTTTTCAATTTTATCGATAAAAAGAAGAGATGAGCAGCACATACATAGTGTGATAAAG
AGGAAAAAAGCAGAAGAAGCAGAAGAAGAAGAGCATAGTAAAAAAGTAGTGCTAAAAAGG
TGCGGTACGGAAACACAGGAAATATATCAGAGAAGAAATA
Chr coordinates Chr III from 211545-210718
w3c xhtml validator w3c css validator