Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THR4
Systematic Name YCR053W
Strain S288c
Description Threonine synthase, conserved protein that catalyzes formation of threonine from O-phosphohomoserine; expression is regulated by the GCN4-mediated general amino acid control pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THR4 YCR053W
CGCCCAACTTAGCTACCTTGATAGGTATGCAAACGGGCTCCGTTAATGACGCGGTTTATT
CGATCTACAAGTACATTTTGATCAACAATCTGTTTGTTACGGAACAAACAGAGGCTCAAG
ATGGTTCCAACGATGCCGAAGACAGCAGTAACGAGAATAACAATAAAAACGGTGCTGGTG
ACGATGATGGCGTCGAGGGAAGTACTCCAAAGGATAAGCCCGAATTGGGTGAAGTGAAGC
TAGATTCACTCTTACAAAAGGTATTGGATACAAACGCCGCGCACCTCCCCTTGATGAATG
TTGTGCAAACCGTGAACAAACTGGTATCACCCCTACCGCCCATCATCCTAGATTATACAA
TTGATCTTTCCAAAGATACCACCTATGGTGCTACCACCTTGGATGTAGATGTGTCGCACA
TTCTCCACCAGCCTCAACCCCAGCCAAATTTACAAAAAGAGGAAGAAACAGATGCTGAAG
ACACAGCAAAACTACGTGAAATCACAAAGCTTGCCTTGCAGTTGAACTCTAGTGCTCAAA
AATACCAGTTTTTCCACGAACTGTCTTTGCATCCAAGAGAAACGCTGACTCACTACTTAT
GGTCTTCCAAGCAAAACGAGCTTGTGCTGCAGGGCGACCAATACTTCAATGAAGATGCTG
CAAGAACGAGTGACATATACAGTAACAACAACAATGACAGGTCACTAATGGGCAATATCT
CACTACTGTACTCCCAAGGAAGACTATAACATCACTGTATGATCTCATTCTTTCTGCAAT
TATTGCACGCCTCCTCGTGAGTAGTGACCGTGCGAACAAAAGAGTCATTACAACGAGGAA
ATAGAAGAAAATGAAAAATTTTCGACAAAATGTATAGTCATTTCTATCAATAACGTATAC
ACGTTTTTTTAATACTATCTATATTGTGTATCTTATATTTTTCCATTTGGTAGTATAGCA
GCAAATATTTGTTCTTAGACGGCCACCATCCCTCACACCA
Chr coordinates Chr III from 216697-218241
w3c xhtml validator w3c css validator