Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HMRA2
Systematic Name YCR096C
Alias A2
Strain S288c
Description Silenced copy of a2 at HMR; similarity to Alpha2p; required along with a1p for inhibiting expression of the HO endonuclease in a/alpha HO/HO diploid cells with an active mating-type interconversion system
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HMRA2 YCR096C
TCAGTACTCGAAAGATAAACAACCTCCGCCACGACCACACTCTATAAGGCCAAATGTACA
AACACATCTTCCCAATATCCGTCACCACGTACTTCAGCATAATTATTCGTCAACCACTCT
ACAAAACCAAAACCAGGGTTTATAAAATTTTACTGTTGCGGAAAGCTGAAACTAAAAGAA
AAACCCGACTATGCTATTTTAATCATTGAAAACGAATTTATTTAGATCTCATACGTTTAT
TTATGAACTACAAATTGTTAGTATAGGATATATTTAAGTTTGATTCTCATATTACATACC
CAAACTCTTACTTGAAGTGGAGTAATGCCACATTTCTTTGCAACTTCTTCTTTTTCCTTG
GAATTAAGGCTTTGCTTTCTTCTAAAAACCTGTTCTAAAAATGCCCGTGCTTGGGGTGAT
ATTGATGATTTTCCCTTTGGGCTCTTCTCTTTTTTAATGTGGTGGTATATTTCTAACCTA
TTGTTAGAAATATTTTTGTGTAATGTATGTTGCTCTACTTTAGTCAAATTACTTTCCATT
ATAAACTGAAGTATTGTTAGTAAATTGATTCAAAGGCTATCCTTGAAATGAAAACATACA
TTATAAAGATTATTAGTATTGAGATTGATTTCATCAATCTCAGTACCTAGAATGTTAAAC
AGAGTTCTGTTTATGTTTTCCGCCATACTACAAATATCATCCATGTTGTCCTTCTTGATT
TTCTTTGATATAAGGAGATGTATTGTTTTACTTTTCCTTTTTGGAAGTTTTATACAGTTT
CCCCGAAAGAACAAAAATCAAGAATAAAAAGCTCTTTTCTATTTGCTGTAATTTACCTAA
GTTACCAGAGAGTGTAACAACAGAAGAAGAAGTTGAATTAAGGGATATATTAGGATTCTT
ATCTAGGGCCAACAAAAACCGTAAGATTAGTGATGAGGAGAAGAAGTTGTTGCAAACAAC
ATCTCAACTCACTACTACCATTACTGTATTACTCAAAGAA
Chr coordinates Chr III from 293538-293179
w3c xhtml validator w3c css validator