Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GIT1
Systematic Name YCR098C
Strain S288c
Description Plasma membrane permease, mediates uptake of glycerophosphoinositol and glycerophosphocholine as sources of the nutrients inositol and phosphate; expression and transport rate are regulated by phosphate and inositol availability
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GIT1 YCR098C
ATAGATTTTTATTAGTATTTGTTTGCAACAATTCAACGGTTAGTGTATGTAGACTATTGA
ATATAACGAAGATAAACAAAAAGAAGGGGAGCGAAAAAGAATTGTCAACAAATGTTTATC
GATATCTGCGATAAGGTTCTGCAAACAAATGCCGCTTACGAAAAGAATACAAAAATAAGA
GAATACAAGGTTATCAGCCGTCGAAAAGCACATGCTATCGTGTCATCATTTCGTGAACTA
TACTTCTAATGGTGTCTGCACCACAAATACCATATACACATTAGAGCATGACGATGAGTA
CTTACTTTTCTTGACTGTACAGCCACAGATGTTGCAGTGCGTTTCAAAAGTTCCAGCCCC
ACGTTTTGCCAAGATAAATTAAAAAAAGAACGTGCATATGAATATGACAGTATTGAGCAT
AGTCTTTTTGACAGTATCCCCTAAATGCCAGAGTGTCCGCATGATTAATACTTTTCGCGG
CGCACGTGCATGACGGTAAAGAAAGCAGAGAATCAAAAGAAGCAGCACGTAGTAATAGCG
GCGTAGAATGTTGTACCCAACAGCAATGATGTTAGAATAATAGGGGTTATATGATTGGAT
CCTACGGTCTTCCGCGTTGCCGTTTGGTGCCACATTTATCTTCATATTCATGAATTTCCT
TACTGGACCCCCACCTTAGCATGGATTGATTATATAGGCATATGGGCATTCCGTCCACTG
TATCGTAGGATTATTTTCCAACATTAGTTAACTTAGTTCTCTGGTTAACCTAGTTTTTCA
ATCTGGCTATCTTAATTCTTTGATGAGGGACATCTGCTGGAAGACATCCAGAATGTGTCT
GGATGAAGTAGGAAACTCGTGAATATATAAACCCCGATGAATGTAGTTGTAGCAGATGTT
CGTTACAGTATTTATTATCTGTTTCTTGTGACTAGTCAACCAGCCGCAGACGTGAGTTGA
TCTTTTTGCTTATAATCAAAAAAATAGAATAGGATAAAAA
Chr coordinates Chr III from 298605-297049
w3c xhtml validator w3c css validator