Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPD1
Systematic Name YDL022W
Alias DAR1, HOR1, OSG1, OSR5
Strain S288c
Description NAD-dependent glycerol-3-phosphate dehydrogenase; key enzyme of glycerol synthesis, essential for growth under osmotic stress; expression regulated by high-osmolarity glycerol response pathway; protein abundance increases in response to DNA replication stress; constitutively inactivated via phosphorylation by the protein kinases Ypk1p and Ypk2p, dephosphorylation increases catalytic activity; forms a heterodimer with Pnc1p to facilitate its peroxisomal import
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPD1 YDL022W
AGCCCGAAAGAGTTATCGTTACTCCGATTATTTTGTACAGCTGATGGGACCTTGCCGTCT
TCATTTTTTTTTTTTTTCACCTATAGAGCCGGGCAGAGCTGCCCGGCTTAACTAAGGGCC
GGAAAAAAAACGGAAAAAAGAAAGCCAAGCGTGTAGACGTAGTATAACAGTATATCTGAC
ACGCACGTGATGACCACGTAATCGCATCGCCCCTCACCTCTCACCTCTCACCGCTGACTC
AGCTTCACTAAAAAGGAAAATATATACTCTTTCCCAGGCAAGGTGACAGCGGTCCCCGTC
TCCTCCACAAAGGCCTCTCCTGGGGTTTGAGCAAGTCTAAGTTTACGTAGCATAAAAATT
CTCGGATTGCGTCAAATAATAAAAAAAGTAACCCCACTTCTACTTCTACATCGGAAAAAC
ATTCCATTCACATATCGTCTTTGGCCTATCTTGTTTTGTCCTCGGTAGATCAGGTCAGTA
CAAACGCAACACGAAAGAACAAAAAAAGAAGAAAACAGAAGGCCAAGACAGGGTCAATGA
GACTGTTGTCCTCCTACTGTCCCTATGTCTCTGGCCGATCACGCGCCATTGTCCCTCAGA
AACAAATCAAACACCCACACCCCGGGCACCCAAAGTCCCCACCCACACCACCAATACGTA
AACGGGGCGCCCCCTGCAGGCCCTCCTGCGCGCGGCCTCCCGCCTTGCTTCTCTCCCCTT
CCTTTTCTTTTTCCAGTTTTCCCTATTTTGTCCCTTTTTCCGCACAACAAGTATCAGAAT
GGGTTCATCAAATCTATCCAACCTAATTCGCACGTAGACTGGCTTGGTATTGGCAGTTTC
GTAGTTATATATATACTACCATGAGTGAAACTGTTACGTTACCTTAAATTCTTTCTCCCT
TTAATTTTCTTTTATCTTACTCTCCTACATAAGACATCAAGAAACAATTGTATATTGTAC
ACCCCCCCCCTCCACAAACACAAATATTGATAATATAAAG
Chr coordinates Chr IV from 411825-413000
w3c xhtml validator w3c css validator